EMAIL THIS PAGE TO A FRIEND

COQ10B

coenzyme Q10 homolog B (S. cerevisiae)

115 Gene Product Result for
UniProtKB ID: Q9H8M1
Gene ID:
Mouse(67876) coenzyme Q10 homolog B (S. cerevisiae)
Rat(301416) coenzyme Q10 homolog B (S. cerevisiae)
sheep(101122002) coenzyme Q10 homolog B (S. cerevisiae)
naked mole-rat(101706864) coenzyme Q10 homolog B (S. cerevisiae)
domestic guinea pig(100723232) coenzyme Q10 homolog B (S. cerevisiae)
Zebrafish(550442) coenzyme Q10 homolog B (S. cerevisiae)
cow(514221) coenzyme Q10 homolog B (S. cerevisiae)
domestic cat(101088425) coenzyme Q10 homolog B (S. cerevisiae)
dog(478853) coenzyme Q10 homolog B (S. cerevisiae)
chicken(424057) coenzyme Q10 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025147 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025147 Rosetta Predictions human pricing
NM_001009671 Rosetta Predictions rat pricing
NM_001039710 Rosetta Predictions mouse pricing
NM_026424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229328 predicted 920
2 SASI_Hs01_00229329 predicted 571
3 SASI_Hs01_00229330 predicted 934
4 SASI_Hs01_00229331 predicted 225
5 SASI_Hs02_00357880 predicted 702
6 SASI_Hs01_00229333 predicted 905
7 SASI_Hs01_00229334 predicted 876
8 SASI_Hs01_00229335 predicted 1004
9 SASI_Hs01_00229336 predicted 734
10 SASI_Hs02_00357881 predicted 721
11 SASI_Hs01_00229332 predicted 807
12 SASI_Hs01_00229337 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092177 predicted 688
2 SASI_Rn01_00092178 predicted 694
3 SASI_Rn01_00092179 predicted 301
4 SASI_Rn01_00092180 predicted 252
5 SASI_Rn01_00092181 predicted 211
6 SASI_Rn01_00092182 predicted 550
7 SASI_Rn01_00092183 predicted 290
8 SASI_Rn01_00092184 predicted 359
9 SASI_Rn01_00092185 predicted 430
10 SASI_Rn01_00092186 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151540 predicted 984
2 SASI_Mm01_00151541 predicted 1075
3 SASI_Mm01_00151542 predicted 759
4 SASI_Mm01_00151543 predicted 912
5 SASI_Mm01_00151544 predicted 778
6 SASI_Mm01_00151545 predicted 997
7 SASI_Mm01_00151546 predicted 1017
8 SASI_Mm01_00151547 predicted 863
9 SASI_Mm01_00151548 predicted 1098
10 SASI_Mm02_00290237 predicted 1085
11 SASI_Mm01_00151549 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158389 predicted 830
2 SASI_Mm01_00158390 predicted 920
3 SASI_Mm01_00158391 predicted 607
4 SASI_Mm01_00158392 predicted 758
5 SASI_Mm01_00158393 predicted 632
6 SASI_Mm01_00158394 predicted 842
7 SASI_Mm01_00158395 predicted 873
8 SASI_Mm01_00158396 predicted 715
9 SASI_Mm01_00158397 predicted 948
10 SASI_Mm02_00330239 predicted 939
11 SASI_Mm01_00158398 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025147
COQ10B MISSION shRNA Bacterial Glycerol Stock
coenzyme Q10 homolog B (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-222s1c1
Sequence:CCGGCTAAGGAGATATGTGCACGAACTCGAGTTCGTGCACATATCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025147.2-1048s1c1
Sequence:CCGGGAGCAGAAGTTGAAACTGTAACTCGAGTTACAGTTTCAACTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025147.2-863s1c1
Sequence:CCGGGCATTTGTTAAACGCAGCTTTCTCGAGAAAGCTGCGTTTAACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-189s1c1
Sequence:CCGGGCAGAACTCTTCCACTACATACTCGAGTATGTAGTGGAAGAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-195s1c1
Sequence:CCGGCTCTTCCACTACATACCTCAACTCGAGTTGAGGTATGTAGTGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025147.3-443s21c1
Sequence:CCGGCACCTGTGTTGGAGCGATATACTCGAGTATATCGCTCCAACACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025147.3-1199s21c1
Sequence:CCGGGCCGTATGGCTTAGGATATTTCTCGAGAAATATCCTAAGCCATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025147.3-528s21c1
Sequence:CCGGCAATCATTTGGAGACTATTTGCTCGAGCAAATAGTCTCCAAATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025147
COQ10B MISSION shRNA shRNA Plasmid DNA
coenzyme Q10 homolog B (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-222s1c1
Sequence:CCGGCTAAGGAGATATGTGCACGAACTCGAGTTCGTGCACATATCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025147.2-1048s1c1
Sequence:CCGGGAGCAGAAGTTGAAACTGTAACTCGAGTTACAGTTTCAACTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025147.2-863s1c1
Sequence:CCGGGCATTTGTTAAACGCAGCTTTCTCGAGAAAGCTGCGTTTAACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-189s1c1
Sequence:CCGGGCAGAACTCTTCCACTACATACTCGAGTATGTAGTGGAAGAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-195s1c1
Sequence:CCGGCTCTTCCACTACATACCTCAACTCGAGTTGAGGTATGTAGTGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025147.3-443s21c1
Sequence:CCGGCACCTGTGTTGGAGCGATATACTCGAGTATATCGCTCCAACACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025147.3-1199s21c1
Sequence:CCGGGCCGTATGGCTTAGGATATTTCTCGAGAAATATCCTAAGCCATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025147.3-528s21c1
Sequence:CCGGCAATCATTTGGAGACTATTTGCTCGAGCAAATAGTCTCCAAATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025147
COQ10B MISSION shRNA Lentiviral Transduction Particles
coenzyme Q10 homolog B (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-222s1c1
Sequence:CCGGCTAAGGAGATATGTGCACGAACTCGAGTTCGTGCACATATCTCCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133691    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025147.2-1048s1c1
Sequence:CCGGGAGCAGAAGTTGAAACTGTAACTCGAGTTACAGTTTCAACTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025147.2-863s1c1
Sequence:CCGGGCATTTGTTAAACGCAGCTTTCTCGAGAAAGCTGCGTTTAACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-189s1c1
Sequence:CCGGGCAGAACTCTTCCACTACATACTCGAGTATGTAGTGGAAGAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025147.2-195s1c1
Sequence:CCGGCTCTTCCACTACATACCTCAACTCGAGTTGAGGTATGTAGTGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025147.3-443s21c1
Sequence:CCGGCACCTGTGTTGGAGCGATATACTCGAGTATATCGCTCCAACACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424335    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025147.3-1199s21c1
Sequence:CCGGGCCGTATGGCTTAGGATATTTCTCGAGAAATATCCTAAGCCATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025147.3-528s21c1
Sequence:CCGGCAATCATTTGGAGACTATTTGCTCGAGCAAATAGTCTCCAAATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039710
VALIDATED
COQ10B MISSION shRNA Bacterial Glycerol Stock
coenzyme Q10 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-1085s21c1
Sequence:CCGGTGTTGCTAGGATACCACATTCCTCGAGGAATGTGGTATCCTAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-590s21c1
Sequence:CCGGTCAATCATTTGGAGACTATTTCTCGAGAAATAGTCTCCAAATGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-369s21c1
Sequence:CCGGAGGGTACTCAATGCAAGAAATCTCGAGATTTCTTGCATTGAGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-788s21c1
Sequence:CCGGCAAACATACCTCGGGAATTAACTCGAGTTAATTCCCGAGGTATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-231s21c1
Sequence:CCGGTGCCTGTGGTGTACTGATAAACTCGAGTTTATCAGTACACCACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039710
VALIDATED
COQ10B MISSION shRNA shRNA Plasmid DNA
coenzyme Q10 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-1085s21c1
Sequence:CCGGTGTTGCTAGGATACCACATTCCTCGAGGAATGTGGTATCCTAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-590s21c1
Sequence:CCGGTCAATCATTTGGAGACTATTTCTCGAGAAATAGTCTCCAAATGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-369s21c1
Sequence:CCGGAGGGTACTCAATGCAAGAAATCTCGAGATTTCTTGCATTGAGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-788s21c1
Sequence:CCGGCAAACATACCTCGGGAATTAACTCGAGTTAATTCCCGAGGTATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-231s21c1
Sequence:CCGGTGCCTGTGGTGTACTGATAAACTCGAGTTTATCAGTACACCACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039710
VALIDATED
COQ10B MISSION shRNA Lentiviral Transduction Particles
coenzyme Q10 homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-1085s21c1
Sequence:CCGGTGTTGCTAGGATACCACATTCCTCGAGGAATGTGGTATCCTAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-590s21c1
Sequence:CCGGTCAATCATTTGGAGACTATTTCTCGAGAAATAGTCTCCAAATGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-369s21c1
Sequence:CCGGAGGGTACTCAATGCAAGAAATCTCGAGATTTCTTGCATTGAGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-788s21c1
Sequence:CCGGCAAACATACCTCGGGAATTAACTCGAGTTAATTCCCGAGGTATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001039710.1-231s21c1
Sequence:CCGGTGCCTGTGGTGTACTGATAAACTCGAGTTTATCAGTACACCACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks