EMAIL THIS PAGE TO A FRIEND

COQ2

coenzyme Q2 4-hydroxybenzoate polyprenyltransferase

44 Gene Product Result for
Synonyms: CL640 COQ10D1 MSA1
UniProtKB ID: Q96H96, O95331, Q1JQ78, Q684R2
Gene ID:
Human(27235) Summary: This gene encodes an enzyme that functions in the final steps in the biosynthesis of CoQ (ubiquinone), a redox carrier in the mitochondrial respiratory chain and a lipid-soluble antioxidant. This enzyme, which is part of the coenzyme Q10 pathway, catalyzes the prenylation of parahydroxybenzoate with an all-trans polyprenyl group. Mutations in this gene cause coenzyme Q10 deficiency, a mitochondrial encephalomyopathy, and also COQ2 nephropathy, an inherited form of mitochondriopathy with primary renal involvement. [provided by RefSeq, Oct 2009]
Mouse(71883) coenzyme Q2 homolog, prenyltransferase (yeast)
Rat(498332) coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Zebrafish(100037331) coenzyme Q2 homolog, prenyltransferase (yeast)
dog(478457) coenzyme Q2 homolog, prenyltransferase (yeast)
cow(504633) coenzyme Q2 homolog, prenyltransferase (yeast)
domestic cat(101084704) coenzyme Q2 homolog, prenyltransferase (yeast)
chicken(422605) coenzyme Q2 homolog, prenyltransferase (yeast)
fruit fly(40988) Coenzyme Q biosynthesis protein 2
domestic guinea pig(100722163) coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
naked mole-rat(101700791) coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
sheep(101109616) coenzyme Q2 homolog, prenyltransferase (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027978 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027978 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027978 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015697 Rosetta Predictions human pricing
NM_001044255 Rosetta Predictions rat pricing
NM_027978 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348361 predicted 774
2 SASI_Hs01_00104162 predicted 377
3 SASI_Hs01_00104163 predicted 565
4 SASI_Hs01_00104164 predicted 1246
5 SASI_Hs01_00104165 predicted 1021
6 SASI_Hs01_00104166 predicted 651
7 SASI_Hs01_00104167 predicted 479
8 SASI_Hs01_00104168 predicted 602
9 SASI_Hs01_00104170 predicted 428
10 SASI_Hs02_00348362 predicted 661
11 SASI_Hs01_00104161 predicted 563
12 SASI_Hs01_00104169 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205267 predicted 434
2 SASI_Rn02_00205268 predicted 611
3 SASI_Rn02_00205269 predicted 769
4 SASI_Rn02_00205270 predicted 1017
5 SASI_Rn02_00205271 predicted 249
6 SASI_Rn02_00205272 predicted 1212
7 SASI_Rn02_00205273 predicted 556
8 SASI_Rn02_00205274 predicted 284
9 SASI_Rn02_00205275 predicted 548
10 SASI_Rn02_00205276 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027978 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194014 predicted 1202
2 SASI_Mm02_00333025 predicted 1306
3 SASI_Mm02_00333026 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015697
VALIDATED
COQ2 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-444s21c1
Sequence:CCGGTGGGACCAGGACTATGATAAACTCGAGTTTATCATAGTCCTGGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-669s21c1
Sequence:CCGGGCCTTGGGCTTGACATTTAATCTCGAGATTAAATGTCAAGCCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-1023s21c1
Sequence:CCGGCCTGAGGATTGTTGGAATAAACTCGAGTTTATTCCAACAATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-1092s21c1
Sequence:CCGGCTTGGGAATTTGTGGAAAGAACTCGAGTTCTTTCCACAAATTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-1498s1c1
Sequence:CCGGCCATTATAATTCTCACCTGAACTCGAGTTCAGGTGAGAATTATAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015697.5-772s1c1
Sequence:CCGGGCCTTGGGCTTGACATTTAATCTCGAGATTAAATGTCAAGCCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-1195s1c1
Sequence:CCGGCTTGGGAATTTGTGGAAAGAACTCGAGTTCTTTCCACAAATTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015697.5-1126s1c1
Sequence:CCGGCCTGAGGATTGTTGGAATAAACTCGAGTTTATTCCAACAATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-547s1c1
Sequence:CCGGTGGGACCAGGACTATGATAAACTCGAGTTTATCATAGTCCTGGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015697
VALIDATED
COQ2 MISSION shRNA shRNA Plasmid DNA
coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-444s21c1
Sequence:CCGGTGGGACCAGGACTATGATAAACTCGAGTTTATCATAGTCCTGGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-669s21c1
Sequence:CCGGGCCTTGGGCTTGACATTTAATCTCGAGATTAAATGTCAAGCCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-1023s21c1
Sequence:CCGGCCTGAGGATTGTTGGAATAAACTCGAGTTTATTCCAACAATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-1092s21c1
Sequence:CCGGCTTGGGAATTTGTGGAAAGAACTCGAGTTCTTTCCACAAATTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-1498s1c1
Sequence:CCGGCCATTATAATTCTCACCTGAACTCGAGTTCAGGTGAGAATTATAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015697.5-772s1c1
Sequence:CCGGGCCTTGGGCTTGACATTTAATCTCGAGATTAAATGTCAAGCCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-1195s1c1
Sequence:CCGGCTTGGGAATTTGTGGAAAGAACTCGAGTTCTTTCCACAAATTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015697.5-1126s1c1
Sequence:CCGGCCTGAGGATTGTTGGAATAAACTCGAGTTTATTCCAACAATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-547s1c1
Sequence:CCGGTGGGACCAGGACTATGATAAACTCGAGTTTATCATAGTCCTGGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015697
VALIDATED
COQ2 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-444s21c1
Sequence:CCGGTGGGACCAGGACTATGATAAACTCGAGTTTATCATAGTCCTGGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-669s21c1
Sequence:CCGGGCCTTGGGCTTGACATTTAATCTCGAGATTAAATGTCAAGCCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-1023s21c1
Sequence:CCGGCCTGAGGATTGTTGGAATAAACTCGAGTTTATTCCAACAATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015697.6-1092s21c1
Sequence:CCGGCTTGGGAATTTGTGGAAAGAACTCGAGTTCTTTCCACAAATTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-1498s1c1
Sequence:CCGGCCATTATAATTCTCACCTGAACTCGAGTTCAGGTGAGAATTATAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015697.5-772s1c1
Sequence:CCGGGCCTTGGGCTTGACATTTAATCTCGAGATTAAATGTCAAGCCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-1195s1c1
Sequence:CCGGCTTGGGAATTTGTGGAAAGAACTCGAGTTCTTTCCACAAATTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015697.5-1126s1c1
Sequence:CCGGCCTGAGGATTGTTGGAATAAACTCGAGTTTATTCCAACAATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015697.5-547s1c1
Sequence:CCGGTGGGACCAGGACTATGATAAACTCGAGTTTATCATAGTCCTGGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027978
COQ2 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027978.1-1492s1c1
Sequence:CCGGCCTTGTTCCTTCTTATCCAAACTCGAGTTTGGATAAGAAGGAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-958s1c1
Sequence:CCGGCCAGATTTACACTGTAGACATCTCGAGATGTCTACAGTGTAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-953s1c1
Sequence:CCGGGCTCACCAGATTTACACTGTACTCGAGTACAGTGTAAATCTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-407s1c1
Sequence:CCGGTGGGACCGTGACTTCGATAAACTCGAGTTTATCGAAGTCACGGTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-1052s1c1
Sequence:CCGGGTCCTTGGAAACCTGTGCAAACTCGAGTTTGCACAGGTTTCCAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027978
COQ2 MISSION shRNA shRNA Plasmid DNA
coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027978.1-1492s1c1
Sequence:CCGGCCTTGTTCCTTCTTATCCAAACTCGAGTTTGGATAAGAAGGAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-958s1c1
Sequence:CCGGCCAGATTTACACTGTAGACATCTCGAGATGTCTACAGTGTAAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-953s1c1
Sequence:CCGGGCTCACCAGATTTACACTGTACTCGAGTACAGTGTAAATCTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-407s1c1
Sequence:CCGGTGGGACCGTGACTTCGATAAACTCGAGTTTATCGAAGTCACGGTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-1052s1c1
Sequence:CCGGGTCCTTGGAAACCTGTGCAAACTCGAGTTTGCACAGGTTTCCAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027978
COQ2 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027978.1-1492s1c1
Sequence:CCGGCCTTGTTCCTTCTTATCCAAACTCGAGTTTGGATAAGAAGGAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-958s1c1
Sequence:CCGGCCAGATTTACACTGTAGACATCTCGAGATGTCTACAGTGTAAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-953s1c1
Sequence:CCGGGCTCACCAGATTTACACTGTACTCGAGTACAGTGTAAATCTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-407s1c1
Sequence:CCGGTGGGACCGTGACTTCGATAAACTCGAGTTTATCGAAGTCACGGTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027978.1-1052s1c1
Sequence:CCGGGTCCTTGGAAACCTGTGCAAACTCGAGTTTGCACAGGTTTCCAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)