EMAIL THIS PAGE TO A FRIEND

COQ3

coenzyme Q3 methyltransferase

51 Gene Product Result for
Synonyms: DHHBMT DHHBMTASE UG0215E05 bA9819.1
Gene ID:
Human(51805) Summary: Ubiquinone, also known as coenzyme Q, or Q, is a critical component of the electron transport pathways of both eukaryotes and prokaryotes (Jonassen and Clarke, 2000 [PubMed 10777520]
Mouse(230027) coenzyme Q3 homolog, methyltransferase (yeast)
Rat(29309) coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
sheep(101103985) coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
naked mole-rat(101715057) coenzyme Q3 methyltransferase
domestic guinea pig(100724558) coenzyme Q3 methyltransferase
Zebrafish(436893) coenzyme Q3 homolog, methyltransferase (yeast)
cow(540298) coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
domestic cat(101084711) coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
dog(475004) coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
chicken(421797) coenzyme Q3 homolog, methyltransferase (S. cerevisiae)
Thale Cress(817642) Hexaprenyldihydroxybenzoate methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017421 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017421 Rosetta Predictions human pricing
NM_019187 Rosetta Predictions rat pricing
NM_172687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146763 predicted 869
2 SASI_Hs01_00146764 predicted 492
3 SASI_Hs01_00146765 predicted 792
4 SASI_Hs02_00349990 predicted 988
5 SASI_Hs02_00349991 predicted 874
6 SASI_Hs01_00146766 predicted 708
7 SASI_Hs01_00146767 predicted 338
8 SASI_Hs01_00146768 predicted 357
9 SASI_Hs01_00146769 predicted 225
10 SASI_Hs01_00146770 predicted 891
11 SASI_Hs01_00146762 predicted 705
12 SASI_Hs01_00146771 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112092 predicted 375
2 SASI_Rn01_00112093 predicted 599
3 SASI_Rn01_00112094 predicted 711
4 SASI_Rn01_00112095 predicted 294
5 SASI_Rn01_00112096 predicted 531
6 SASI_Rn01_00112097 predicted 670
7 SASI_Rn01_00112098 predicted 539
8 SASI_Rn01_00112099 predicted 204
9 SASI_Rn01_00112101 predicted 547
10 SASI_Rn02_00261996 predicted 694
11 SASI_Rn01_00112100 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045475 predicted 898
2 SASI_Mm01_00045476 predicted 485
3 SASI_Mm01_00045477 predicted 345
4 SASI_Mm01_00045478 predicted 252
5 SASI_Mm01_00045479 predicted 1154
6 SASI_Mm01_00045480 predicted 884
7 SASI_Mm01_00045481 predicted 270
8 SASI_Mm01_00045482 predicted 526
9 SASI_Mm01_00045483 predicted 389
10 SASI_Mm01_00045484 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172687
COQ3 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q3 methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172687.1-2368s1c1
Sequence:CCGGCCCGTAGGCTTGTATGTTTAACTCGAGTTAAACATACAAGCCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-815s1c1
Sequence:CCGGGCAGAGCAAATTGCAGGCATTCTCGAGAATGCCTGCAATTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-359s1c1
Sequence:CCGGGCGCCTCTTCATTCTATGAATCTCGAGATTCATAGAATGAAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-139s1c1
Sequence:CCGGGCTCACTAGGAATCTACAGATCTCGAGATCTGTAGATTCCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-361s1c1
Sequence:CCGGGCCTCTTCATTCTATGAATGACTCGAGTCATTCATAGAATGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172687
COQ3 MISSION shRNA shRNA Plasmid DNA
coenzyme Q3 methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172687.1-2368s1c1
Sequence:CCGGCCCGTAGGCTTGTATGTTTAACTCGAGTTAAACATACAAGCCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-815s1c1
Sequence:CCGGGCAGAGCAAATTGCAGGCATTCTCGAGAATGCCTGCAATTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-359s1c1
Sequence:CCGGGCGCCTCTTCATTCTATGAATCTCGAGATTCATAGAATGAAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-139s1c1
Sequence:CCGGGCTCACTAGGAATCTACAGATCTCGAGATCTGTAGATTCCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-361s1c1
Sequence:CCGGGCCTCTTCATTCTATGAATGACTCGAGTCATTCATAGAATGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172687
COQ3 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q3 methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172687.1-2368s1c1
Sequence:CCGGCCCGTAGGCTTGTATGTTTAACTCGAGTTAAACATACAAGCCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-815s1c1
Sequence:CCGGGCAGAGCAAATTGCAGGCATTCTCGAGAATGCCTGCAATTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-359s1c1
Sequence:CCGGGCGCCTCTTCATTCTATGAATCTCGAGATTCATAGAATGAAGAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-139s1c1
Sequence:CCGGGCTCACTAGGAATCTACAGATCTCGAGATCTGTAGATTCCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172687.1-361s1c1
Sequence:CCGGGCCTCTTCATTCTATGAATGACTCGAGTCATTCATAGAATGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017421
VALIDATED
COQ3 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q3 methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-335s1c1
Sequence:CCGGGCTCACAAATGGTGGGATGAACTCGAGTTCATCCCACCATTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-114s1c1
Sequence:CCGGCCTTAATTTCCTCGGCGGTTTCTCGAGAAACCGCCGAGGAAATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_017421.2-756s1c1
Sequence:CCGGCCGGTGGTTCTTTATTCATTACTCGAGTAATGAATAAAGAACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017421.2-884s1c1
Sequence:CCGGCCTGAAACACTAGAGAGCATTCTCGAGAATGCTCTCTAGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-599s1c1
Sequence:CCGGCCAGTCCTGGATAAGAGAATACTCGAGTATTCTCTTATCCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-349s21c1
Sequence:CCGGTGGGATGAACAAGGAGTATATCTCGAGATATACTCCTTGTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-154s21c1
Sequence:CCGGAGTGGGACTCTACAGATTAAACTCGAGTTTAATCTGTAGAGTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-826s21c1
Sequence:CCGGTCAGAGCAAATTGCAAGTATTCTCGAGAATACTTGCAATTTGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-936s21c1
Sequence:CCGGAGTGGTAGGAATGCTCTATAACTCGAGTTATAGAGCATTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-119s21c1
Sequence:CCGGTAATTTCCTCGGCGGTTTATGCTCGAGCATAAACCGCCGAGGAAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017421
VALIDATED
COQ3 MISSION shRNA shRNA Plasmid DNA
coenzyme Q3 methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-335s1c1
Sequence:CCGGGCTCACAAATGGTGGGATGAACTCGAGTTCATCCCACCATTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-114s1c1
Sequence:CCGGCCTTAATTTCCTCGGCGGTTTCTCGAGAAACCGCCGAGGAAATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_017421.2-756s1c1
Sequence:CCGGCCGGTGGTTCTTTATTCATTACTCGAGTAATGAATAAAGAACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017421.2-884s1c1
Sequence:CCGGCCTGAAACACTAGAGAGCATTCTCGAGAATGCTCTCTAGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-599s1c1
Sequence:CCGGCCAGTCCTGGATAAGAGAATACTCGAGTATTCTCTTATCCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-349s21c1
Sequence:CCGGTGGGATGAACAAGGAGTATATCTCGAGATATACTCCTTGTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-154s21c1
Sequence:CCGGAGTGGGACTCTACAGATTAAACTCGAGTTTAATCTGTAGAGTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-826s21c1
Sequence:CCGGTCAGAGCAAATTGCAAGTATTCTCGAGAATACTTGCAATTTGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-936s21c1
Sequence:CCGGAGTGGTAGGAATGCTCTATAACTCGAGTTATAGAGCATTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-119s21c1
Sequence:CCGGTAATTTCCTCGGCGGTTTATGCTCGAGCATAAACCGCCGAGGAAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017421
VALIDATED
COQ3 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q3 methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-335s1c1
Sequence:CCGGGCTCACAAATGGTGGGATGAACTCGAGTTCATCCCACCATTTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-114s1c1
Sequence:CCGGCCTTAATTTCCTCGGCGGTTTCTCGAGAAACCGCCGAGGAAATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_017421.2-756s1c1
Sequence:CCGGCCGGTGGTTCTTTATTCATTACTCGAGTAATGAATAAAGAACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_017421.2-884s1c1
Sequence:CCGGCCTGAAACACTAGAGAGCATTCTCGAGAATGCTCTCTAGTGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017421.2-599s1c1
Sequence:CCGGCCAGTCCTGGATAAGAGAATACTCGAGTATTCTCTTATCCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-349s21c1
Sequence:CCGGTGGGATGAACAAGGAGTATATCTCGAGATATACTCCTTGTTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-154s21c1
Sequence:CCGGAGTGGGACTCTACAGATTAAACTCGAGTTTAATCTGTAGAGTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-826s21c1
Sequence:CCGGTCAGAGCAAATTGCAAGTATTCTCGAGAATACTTGCAATTTGCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-936s21c1
Sequence:CCGGAGTGGTAGGAATGCTCTATAACTCGAGTTATAGAGCATTCCTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017421.3-119s21c1
Sequence:CCGGTAATTTCCTCGGCGGTTTATGCTCGAGCATAAACCGCCGAGGAAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks