EMAIL THIS PAGE TO A FRIEND

COQ4

coenzyme Q4 homolog (S. cerevisiae)

51 Gene Product Result for
Synonyms: CGI-92
UniProtKB ID: Q9Y3A0, A8WBK8, B2R958, Q5T4B8, Q96EW4
Gene ID:
Human(51117) Summary: Coenzyme Q (CoQ) is a small lipophilic molecule that transports electrons between mitochondrial respiratory chain complexes and functions as a cofactor for mitochondrial enzymes. COQ4 is an enzyme involved in CoQ biosynthesis (Casarin et al., 2008 [PubMed 18474229]
Mouse(227683) coenzyme Q4 homolog (yeast)
Rat(366013) coenzyme Q4 homolog (S. cerevisiae)
Zebrafish(100137123) coenzyme Q4 homolog (S. cerevisiae)
cow(511987) coenzyme Q4 homolog (S. cerevisiae)
domestic cat(101099757) coenzyme Q4 homolog (S. cerevisiae)
dog(609040) coenzyme Q4 homolog (S. cerevisiae)
chicken(417219) coenzyme Q4 homolog (S. cerevisiae)
domestic guinea pig(100716264) coenzyme Q4 homolog (S. cerevisiae)
naked mole-rat(101697610) coenzyme Q4 homolog (S. cerevisiae)
sheep(101120646) coenzyme Q4 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016035 Rosetta Predictions human pricing
NM_001031662 Rosetta Predictions rat pricing
NM_178693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172502 predicted 1239
2 SASI_Hs01_00172503 predicted 397
3 SASI_Hs01_00172504 predicted 1237
4 SASI_Hs02_00348745 predicted 1258
5 SASI_Hs02_00348746 predicted 1033
6 SASI_Hs01_00172505 predicted 1209
7 SASI_Hs01_00172506 predicted 1245
8 SASI_Hs01_00172507 predicted 713
9 SASI_Hs02_00348747 predicted 1030
10 SASI_Hs01_00172509 predicted 1100
11 SASI_Hs01_00172501 predicted 1097
12 SASI_Hs01_00172508 predicted 1005
13 SASI_Hs01_00172510 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073166 predicted 322
2 SASI_Rn01_00073167 predicted 872
3 SASI_Rn01_00073168 predicted 380
4 SASI_Rn01_00073169 predicted 396
5 SASI_Rn01_00073170 predicted 314
6 SASI_Rn01_00073171 predicted 655
7 SASI_Rn02_00203608 predicted 525
8 SASI_Rn01_00073172 predicted 822
9 SASI_Rn01_00073173 predicted 477
10 SASI_Rn01_00073175 predicted 312
11 SASI_Rn01_00073174 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165061 predicted 480
2 SASI_Mm01_00165062 predicted 671
3 SASI_Mm02_00349187 predicted 926
4 SASI_Mm01_00165063 predicted 1299
5 SASI_Mm01_00165065 predicted 863
6 SASI_Mm01_00165066 predicted 1033
7 SASI_Mm01_00165067 predicted 1120
8 SASI_Mm01_00165068 predicted 539
9 SASI_Mm01_00165069 predicted 1227
10 SASI_Mm01_00165070 predicted 559
11 SASI_Mm01_00165064 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016035
VALIDATED
COQ4 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q4 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-719s21c1
Sequence:CCGGTCGCGAGTATCTCCGTTTCCTCTCGAGAGGAAACGGAGATACTCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-1037s21c1
Sequence:CCGGATGTGTCCTCAACCTGTACTACTCGAGTAGTACAGGTTGAGGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-983s21c1
Sequence:CCGGAGTGCTGGTCTCGGAGTTGATCTCGAGATCAACTCCGAGACCAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-930s21c1
Sequence:CCGGTGCATCCTGGGTGCATTCTTTCTCGAGAAAGAATGCACCCAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016035.3-1367s21c1
Sequence:CCGGGAACCATGCATGAACAGTATCCTCGAGGATACTGTTCATGCATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-546s21c1
Sequence:CCGGCACGACATGGTCGCAGTTCTACTCGAGTAGAACTGCGACCATGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-764s1c1
Sequence:CCGGGATGATGAGGAGCTAGCGTATCTCGAGATACGCTAGCTCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_016035.1-863s1c1
Sequence:CCGGGTGGTGAAATGGTTTGAGGCTCTCGAGAGCCTCAAACCATTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-779s1c1
Sequence:CCGGGCGTATGTAATTCAGCGGTACCTCGAGGTACCGCTGAATTACATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-1009s1c1
Sequence:CCGGCCATTGTGTCCTCAACCTGTACTCGAGTACAGGTTGAGGACACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-1223s1c1
Sequence:CCGGCCCTTGGACAACATTTATCATCTCGAGATGATAAATGTTGTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016035.1-1219s1c1
Sequence:CCGGCTGACCCTTGGACAACATTTACTCGAGTAAATGTTGTCCAAGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-857s1c1
Sequence:CCGGGAGATCGTGGTGAAATGGTTTCTCGAGAAACCATTTCACCACGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-770s1c1
Sequence:CCGGGAGGAGCTAGCGTATGTAATTCTCGAGAATTACATACGCTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016035
VALIDATED
COQ4 MISSION shRNA shRNA Plasmid DNA
coenzyme Q4 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-719s21c1
Sequence:CCGGTCGCGAGTATCTCCGTTTCCTCTCGAGAGGAAACGGAGATACTCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-1037s21c1
Sequence:CCGGATGTGTCCTCAACCTGTACTACTCGAGTAGTACAGGTTGAGGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-983s21c1
Sequence:CCGGAGTGCTGGTCTCGGAGTTGATCTCGAGATCAACTCCGAGACCAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-930s21c1
Sequence:CCGGTGCATCCTGGGTGCATTCTTTCTCGAGAAAGAATGCACCCAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016035.3-1367s21c1
Sequence:CCGGGAACCATGCATGAACAGTATCCTCGAGGATACTGTTCATGCATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-546s21c1
Sequence:CCGGCACGACATGGTCGCAGTTCTACTCGAGTAGAACTGCGACCATGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-764s1c1
Sequence:CCGGGATGATGAGGAGCTAGCGTATCTCGAGATACGCTAGCTCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_016035.1-863s1c1
Sequence:CCGGGTGGTGAAATGGTTTGAGGCTCTCGAGAGCCTCAAACCATTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-779s1c1
Sequence:CCGGGCGTATGTAATTCAGCGGTACCTCGAGGTACCGCTGAATTACATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-1009s1c1
Sequence:CCGGCCATTGTGTCCTCAACCTGTACTCGAGTACAGGTTGAGGACACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-1223s1c1
Sequence:CCGGCCCTTGGACAACATTTATCATCTCGAGATGATAAATGTTGTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016035.1-1219s1c1
Sequence:CCGGCTGACCCTTGGACAACATTTACTCGAGTAAATGTTGTCCAAGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-857s1c1
Sequence:CCGGGAGATCGTGGTGAAATGGTTTCTCGAGAAACCATTTCACCACGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-770s1c1
Sequence:CCGGGAGGAGCTAGCGTATGTAATTCTCGAGAATTACATACGCTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016035
VALIDATED
COQ4 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q4 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-719s21c1
Sequence:CCGGTCGCGAGTATCTCCGTTTCCTCTCGAGAGGAAACGGAGATACTCGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-1037s21c1
Sequence:CCGGATGTGTCCTCAACCTGTACTACTCGAGTAGTACAGGTTGAGGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-983s21c1
Sequence:CCGGAGTGCTGGTCTCGGAGTTGATCTCGAGATCAACTCCGAGACCAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-930s21c1
Sequence:CCGGTGCATCCTGGGTGCATTCTTTCTCGAGAAAGAATGCACCCAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016035.3-1367s21c1
Sequence:CCGGGAACCATGCATGAACAGTATCCTCGAGGATACTGTTCATGCATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016035.3-546s21c1
Sequence:CCGGCACGACATGGTCGCAGTTCTACTCGAGTAGAACTGCGACCATGTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-764s1c1
Sequence:CCGGGATGATGAGGAGCTAGCGTATCTCGAGATACGCTAGCTCCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_016035.1-863s1c1
Sequence:CCGGGTGGTGAAATGGTTTGAGGCTCTCGAGAGCCTCAAACCATTTCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-779s1c1
Sequence:CCGGGCGTATGTAATTCAGCGGTACCTCGAGGTACCGCTGAATTACATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-1009s1c1
Sequence:CCGGCCATTGTGTCCTCAACCTGTACTCGAGTACAGGTTGAGGACACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_016035.1-1223s1c1
Sequence:CCGGCCCTTGGACAACATTTATCATCTCGAGATGATAAATGTTGTCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016035.1-1219s1c1
Sequence:CCGGCTGACCCTTGGACAACATTTACTCGAGTAAATGTTGTCCAAGGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-857s1c1
Sequence:CCGGGAGATCGTGGTGAAATGGTTTCTCGAGAAACCATTTCACCACGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016035.1-770s1c1
Sequence:CCGGGAGGAGCTAGCGTATGTAATTCTCGAGAATTACATACGCTAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178693
VALIDATED
COQ4 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q4 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-553s21c1
Sequence:CCGGGCTCGGAGAGGTTGTGGTAAACTCGAGTTTACCACAACCTCTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178693.4-1053s21c1
Sequence:CCGGATTGGATCATACTGATCATTGCTCGAGCAATGATCAGTATGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-255s21c1
Sequence:CCGGCAGGATGCCACACCCTGAAATCTCGAGATTTCAGGGTGTGGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-716s21c1
Sequence:CCGGTGTGTCCTCAACATCTACTATCTCGAGATAGTAGATGTTGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-407s21c1
Sequence:CCGGCTTCGCTTCCTGGATGTGAATCTCGAGATTCACATCCAGGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178693.2-1548s1c1
Sequence:CCGGCCACACAAATAAACACACAAACTCGAGTTTGTGTGTTTATTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-408s1c1
Sequence:CCGGCTTCGCTTCCTGGATGTGAATCTCGAGATTCACATCCAGGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-456s1c1
Sequence:CCGGACACGCTTTGTGGACGATGAACTCGAGTTCATCGTCCACAAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-717s1c1
Sequence:CCGGTGTGTCCTCAACATCTACTATCTCGAGATAGTAGATGTTGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178693.2-222s1c1
Sequence:CCGGCGCCACGACATGGTTGCAGTTCTCGAGAACTGCAACCATGTCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178693
VALIDATED
COQ4 MISSION shRNA shRNA Plasmid DNA
coenzyme Q4 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-553s21c1
Sequence:CCGGGCTCGGAGAGGTTGTGGTAAACTCGAGTTTACCACAACCTCTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178693.4-1053s21c1
Sequence:CCGGATTGGATCATACTGATCATTGCTCGAGCAATGATCAGTATGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-255s21c1
Sequence:CCGGCAGGATGCCACACCCTGAAATCTCGAGATTTCAGGGTGTGGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-716s21c1
Sequence:CCGGTGTGTCCTCAACATCTACTATCTCGAGATAGTAGATGTTGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-407s21c1
Sequence:CCGGCTTCGCTTCCTGGATGTGAATCTCGAGATTCACATCCAGGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178693.2-1548s1c1
Sequence:CCGGCCACACAAATAAACACACAAACTCGAGTTTGTGTGTTTATTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-408s1c1
Sequence:CCGGCTTCGCTTCCTGGATGTGAATCTCGAGATTCACATCCAGGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-456s1c1
Sequence:CCGGACACGCTTTGTGGACGATGAACTCGAGTTCATCGTCCACAAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-717s1c1
Sequence:CCGGTGTGTCCTCAACATCTACTATCTCGAGATAGTAGATGTTGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178693.2-222s1c1
Sequence:CCGGCGCCACGACATGGTTGCAGTTCTCGAGAACTGCAACCATGTCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178693
VALIDATED
COQ4 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q4 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-553s21c1
Sequence:CCGGGCTCGGAGAGGTTGTGGTAAACTCGAGTTTACCACAACCTCTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178693.4-1053s21c1
Sequence:CCGGATTGGATCATACTGATCATTGCTCGAGCAATGATCAGTATGATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-255s21c1
Sequence:CCGGCAGGATGCCACACCCTGAAATCTCGAGATTTCAGGGTGTGGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-716s21c1
Sequence:CCGGTGTGTCCTCAACATCTACTATCTCGAGATAGTAGATGTTGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178693.4-407s21c1
Sequence:CCGGCTTCGCTTCCTGGATGTGAATCTCGAGATTCACATCCAGGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178693.2-1548s1c1
Sequence:CCGGCCACACAAATAAACACACAAACTCGAGTTTGTGTGTTTATTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-408s1c1
Sequence:CCGGCTTCGCTTCCTGGATGTGAATCTCGAGATTCACATCCAGGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-456s1c1
Sequence:CCGGACACGCTTTGTGGACGATGAACTCGAGTTCATCGTCCACAAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178693.2-717s1c1
Sequence:CCGGTGTGTCCTCAACATCTACTATCTCGAGATAGTAGATGTTGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178693.2-222s1c1
Sequence:CCGGCGCCACGACATGGTTGCAGTTCTCGAGAACTGCAACCATGTCGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks