EMAIL THIS PAGE TO A FRIEND

COQ5

coenzyme Q5 homolog, methyltransferase (S. cerevisiae)

60 Gene Product Result for
UniProtKB ID: Q5HYK3, B4DEJ4, Q32Q28, Q53HH0, Q96LV1, Q9BSP8
Gene ID:
Mouse(52064) coenzyme Q5 homolog, methyltransferase (yeast)
Rat(304542) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
sheep(101119164) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
naked mole-rat(101726609) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
domestic guinea pig(100723688) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
chicken(416975) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
dog(611501) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
cow(533208) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
domestic cat(101096923) coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090441 MISSION® esiRNA esiRNA human COQ5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032314 Rosetta Predictions human pricing
NM_001039022 Rosetta Predictions rat pricing
XM_001080302 Rosetta Predictions rat pricing
NM_026504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104547 predicted 1022
2 SASI_Hs01_00104548 predicted 1061
3 SASI_Hs01_00104549 predicted 982
4 SASI_Hs01_00104550 predicted 627
5 SASI_Hs01_00104551 predicted 939
6 SASI_Hs01_00104552 predicted 926
7 SASI_Hs02_00359663 predicted 375
8 SASI_Hs02_00359664 predicted 232
9 SASI_Hs01_00104554 predicted 616
10 SASI_Hs01_00104555 predicted 916
11 SASI_Hs01_00104553 predicted 237
12 SASI_Hs01_00104556 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058844 predicted 608
2 SASI_Rn01_00058845 predicted 861
3 SASI_Rn01_00058846 predicted 199
4 SASI_Rn01_00058847 predicted 1061
5 SASI_Rn01_00058848 predicted 907
6 SASI_Rn01_00058849 predicted 450
7 SASI_Rn01_00058850 predicted 840
8 SASI_Rn01_00058851 predicted 625
9 SASI_Rn01_00058852 predicted 596
10 SASI_Rn01_00058853 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367527 predicted 629
2 SASI_Rn02_00367528 predicted 1292
3 SASI_Rn02_00367529 predicted 665
4 SASI_Rn02_00367530 predicted 1479
5 SASI_Rn02_00367531 predicted 360
6 SASI_Rn02_00367532 predicted 1333
7 SASI_Rn02_00367533 predicted 920
8 SASI_Rn02_00367534 predicted 1261
9 SASI_Rn02_00367535 predicted 1387
10 SASI_Rn02_00367536 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045642 predicted 764
2 SASI_Mm02_00330402 predicted 634
3 SASI_Mm01_00045643 predicted 202
4 SASI_Mm01_00045644 predicted 362
5 SASI_Mm01_00045645 predicted 854
6 SASI_Mm01_00045646 predicted 764
7 SASI_Mm01_00045647 predicted 616
8 SASI_Mm01_00045648 predicted 234
9 SASI_Mm01_00045650 predicted 244
10 SASI_Mm01_00045651 predicted 1083
11 SASI_Mm01_00045649 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032314
VALIDATED
COQ5 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-1201s1c1
Sequence:CCGGCCAGAGGCATTTGGTCTGTATCTCGAGATACAGACCAAATGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-942s1c1
Sequence:CCGGCGAAAGTCTAACATCAGGCATCTCGAGATGCCTGATGTTAGACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-1104s1c1
Sequence:CCGGGCCTTGGACTCATGTTTGAATCTCGAGATTCAAACATGAGTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-269s1c1
Sequence:CCGGGTCTTGGTATCCATCGTGTTTCTCGAGAAACACGATGGATACCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032314.2-640s1c1
Sequence:CCGGGATATTTACACCATTGCCTTTCTCGAGAAAGGCAATGGTGTAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032314.2-663s1c1
Sequence:CCGGGATCCGGAATGTCACACACATCTCGAGATGTGTGTGACATTCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032314
VALIDATED
COQ5 MISSION shRNA shRNA Plasmid DNA
coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-1201s1c1
Sequence:CCGGCCAGAGGCATTTGGTCTGTATCTCGAGATACAGACCAAATGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-942s1c1
Sequence:CCGGCGAAAGTCTAACATCAGGCATCTCGAGATGCCTGATGTTAGACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-1104s1c1
Sequence:CCGGGCCTTGGACTCATGTTTGAATCTCGAGATTCAAACATGAGTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-269s1c1
Sequence:CCGGGTCTTGGTATCCATCGTGTTTCTCGAGAAACACGATGGATACCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032314.2-640s1c1
Sequence:CCGGGATATTTACACCATTGCCTTTCTCGAGAAAGGCAATGGTGTAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032314.2-663s1c1
Sequence:CCGGGATCCGGAATGTCACACACATCTCGAGATGTGTGTGACATTCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032314
VALIDATED
COQ5 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-1201s1c1
Sequence:CCGGCCAGAGGCATTTGGTCTGTATCTCGAGATACAGACCAAATGCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-942s1c1
Sequence:CCGGCGAAAGTCTAACATCAGGCATCTCGAGATGCCTGATGTTAGACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161988    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-1104s1c1
Sequence:CCGGGCCTTGGACTCATGTTTGAATCTCGAGATTCAAACATGAGTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032314.2-269s1c1
Sequence:CCGGGTCTTGGTATCCATCGTGTTTCTCGAGAAACACGATGGATACCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032314.2-640s1c1
Sequence:CCGGGATATTTACACCATTGCCTTTCTCGAGAAAGGCAATGGTGTAAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032314.2-663s1c1
Sequence:CCGGGATCCGGAATGTCACACACATCTCGAGATGTGTGTGACATTCCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026504
VALIDATED
COQ5 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-1365s1c1
Sequence:CCGGCCACATCAGAACGCTGACAATCTCGAGATTGTCAGCGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026504.1-851s1c1
Sequence:CCGGCCTACCAATACCTTGTGGAAACTCGAGTTTCCACAAGGTATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-756s1c1
Sequence:CCGGCCAAGTGAATGACCCTCTCATCTCGAGATGAGAGGGTCATTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-839s1c1
Sequence:CCGGGAGACTGGAAGTCCTACCAATCTCGAGATTGGTAGGACTTCCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026504.1-286s1c1
Sequence:CCGGCGAGCTTGGAAGGATTTGCTTCTCGAGAAGCAAATCCTTCCAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-372s21c1
Sequence:CCGGGCGTTCCGGTTCCTTAGTTACCTCGAGGTAACTAAGGAACCGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-629s21c1
Sequence:CCGGTGACGACAGCTTTGATGTTTACTCGAGTAAACATCAAAGCTGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-850s21c1
Sequence:CCGGCCTACCAATACCTTGTGGAAACTCGAGTTTCCACAAGGTATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-1364s21c1
Sequence:CCGGCCACATCAGAACGCTGACAATCTCGAGATTGTCAGCGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-755s21c1
Sequence:CCGGCCAAGTGAATGACCCTCTCATCTCGAGATGAGAGGGTCATTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026504
VALIDATED
COQ5 MISSION shRNA shRNA Plasmid DNA
coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-1365s1c1
Sequence:CCGGCCACATCAGAACGCTGACAATCTCGAGATTGTCAGCGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026504.1-851s1c1
Sequence:CCGGCCTACCAATACCTTGTGGAAACTCGAGTTTCCACAAGGTATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-756s1c1
Sequence:CCGGCCAAGTGAATGACCCTCTCATCTCGAGATGAGAGGGTCATTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-839s1c1
Sequence:CCGGGAGACTGGAAGTCCTACCAATCTCGAGATTGGTAGGACTTCCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026504.1-286s1c1
Sequence:CCGGCGAGCTTGGAAGGATTTGCTTCTCGAGAAGCAAATCCTTCCAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-372s21c1
Sequence:CCGGGCGTTCCGGTTCCTTAGTTACCTCGAGGTAACTAAGGAACCGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-629s21c1
Sequence:CCGGTGACGACAGCTTTGATGTTTACTCGAGTAAACATCAAAGCTGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-850s21c1
Sequence:CCGGCCTACCAATACCTTGTGGAAACTCGAGTTTCCACAAGGTATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-1364s21c1
Sequence:CCGGCCACATCAGAACGCTGACAATCTCGAGATTGTCAGCGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-755s21c1
Sequence:CCGGCCAAGTGAATGACCCTCTCATCTCGAGATGAGAGGGTCATTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026504
VALIDATED
COQ5 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q5 homolog, methyltransferase (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-1365s1c1
Sequence:CCGGCCACATCAGAACGCTGACAATCTCGAGATTGTCAGCGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026504.1-851s1c1
Sequence:CCGGCCTACCAATACCTTGTGGAAACTCGAGTTTCCACAAGGTATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-756s1c1
Sequence:CCGGCCAAGTGAATGACCCTCTCATCTCGAGATGAGAGGGTCATTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026504.1-839s1c1
Sequence:CCGGGAGACTGGAAGTCCTACCAATCTCGAGATTGGTAGGACTTCCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026504.1-286s1c1
Sequence:CCGGCGAGCTTGGAAGGATTTGCTTCTCGAGAAGCAAATCCTTCCAAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-372s21c1
Sequence:CCGGGCGTTCCGGTTCCTTAGTTACCTCGAGGTAACTAAGGAACCGGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-629s21c1
Sequence:CCGGTGACGACAGCTTTGATGTTTACTCGAGTAAACATCAAAGCTGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-850s21c1
Sequence:CCGGCCTACCAATACCTTGTGGAAACTCGAGTTTCCACAAGGTATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-1364s21c1
Sequence:CCGGCCACATCAGAACGCTGACAATCTCGAGATTGTCAGCGTTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026504.2-755s21c1
Sequence:CCGGCCAAGTGAATGACCCTCTCATCTCGAGATGAGAGGGTCATTCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks