EMAIL THIS PAGE TO A FRIEND

COQ6

coenzyme Q6 monooxygenase

71 Gene Product Result for
Synonyms: CGI10 COQ10D6
UniProtKB ID: Q9Y2Z9, B7Z3K8, Q53GG6, Q86U30, Q96CA1, Q96CK2
Gene ID:
Human(51004) Summary: The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Mouse(217707) coenzyme Q6 homolog (yeast)
Rat(299195) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
Zebrafish(751691) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
cow(511624) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
Horse(100056420) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
domestic cat(101090023) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
dog(490778) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
chicken(423342) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
domestic guinea pig(100731940) coenzyme Q6 monooxygenase
naked mole-rat(101706068) coenzyme Q6 monooxygenase
sheep(101105664) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
Domestic Rabbit(100342074) coenzyme Q6 homolog, monooxygenase (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182476 Rosetta Predictions human pricing
NM_182480 Rosetta Predictions human pricing
NM_001011983 Rosetta Predictions rat pricing
XM_576073 Rosetta Predictions rat pricing
NM_172582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048520 predicted 806
2 SASI_Hs01_00048522 predicted 665
3 SASI_Hs01_00048523 predicted 1316
4 SASI_Hs01_00048524 predicted 1268
5 SASI_Hs01_00048525 predicted 867
6 SASI_Hs01_00048527 predicted 753
7 SASI_Hs01_00048528 predicted 1016
8 SASI_Hs01_00048529 predicted 759
9 SASI_Hs02_00370496 predicted 842
10 SASI_Hs02_00370497 predicted 764
11 SASI_Hs01_00048521 predicted 785
12 SASI_Hs01_00048526 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228712 predicted 743
2 SASI_Hs01_00228714 predicted 601
3 SASI_Hs01_00228715 predicted 1260
4 SASI_Hs01_00228716 predicted 1200
5 SASI_Hs01_00228717 predicted 810
6 SASI_Hs01_00228719 predicted 689
7 SASI_Hs01_00228720 predicted 960
8 SASI_Hs01_00228721 predicted 695
9 SASI_Hs02_00370498 predicted 778
10 SASI_Hs02_00370499 predicted 702
11 SASI_Hs01_00228713 predicted 728
12 SASI_Hs01_00228718 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074606 predicted 758
2 SASI_Rn01_00074607 predicted 425
3 SASI_Rn02_00200011 predicted 1294
4 SASI_Rn01_00074608 predicted 210
5 SASI_Rn01_00074609 predicted 807
6 SASI_Rn01_00074610 predicted 532
7 SASI_Rn01_00074611 predicted 1224
8 SASI_Rn01_00074612 predicted 833
9 SASI_Rn01_00074614 predicted 1400
10 SASI_Rn01_00074615 predicted 276
11 SASI_Rn01_00074613 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175801 predicted 787
2 SASI_Rn01_00175802 predicted 448
3 SASI_Rn01_00175803 predicted 242
4 SASI_Rn01_00175804 predicted 844
5 SASI_Rn01_00175805 predicted 554
6 SASI_Rn01_00175806 predicted 1248
7 SASI_Rn01_00175807 predicted 861
8 SASI_Rn01_00175808 predicted 1232
9 SASI_Rn01_00175809 predicted 1426
10 SASI_Rn01_00175810 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055503 predicted 928
2 SASI_Mm01_00055504 predicted 1213
3 SASI_Mm01_00055505 predicted 731
4 SASI_Mm01_00055506 predicted 391
5 SASI_Mm01_00055507 predicted 466
6 SASI_Mm01_00055508 predicted 399
7 SASI_Mm01_00055509 predicted 788
8 SASI_Mm01_00055511 predicted 416
9 SASI_Mm01_00055512 predicted 1259
10 SASI_Mm02_00344260 predicted 809
11 SASI_Mm01_00055510 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172582
COQ6 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q6 monooxygenase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-1191s21c1
Sequence:CCGGGCTTGGTTCATCATCTCAGTACTCGAGTACTGAGATGATGAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-412s21c1
Sequence:CCGGGATAATGTTCGACAGGGACAACTCGAGTTGTCCCTGTCGAACATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-346s21c1
Sequence:CCGGCATCTGCAATATGCGCTGCAACTCGAGTTGCAGCGCATATTGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-587s21c1
Sequence:CCGGCCTTGGGTCCATATTACCCTACTCGAGTAGGGTAATATGGACCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-349s1c1
Sequence:CCGGCATCTGCAATATGCGCTGCAACTCGAGTTGCAGCGCATATTGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-1194s1c1
Sequence:CCGGGCTTGGTTCATCATCTCAGTACTCGAGTACTGAGATGATGAACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-590s1c1
Sequence:CCGGCCTTGGGTCCATATTACCCTACTCGAGTAGGGTAATATGGACCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-415s1c1
Sequence:CCGGGATAATGTTCGACAGGGACAACTCGAGTTGTCCCTGTCGAACATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172582
COQ6 MISSION shRNA shRNA Plasmid DNA
coenzyme Q6 monooxygenase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-1191s21c1
Sequence:CCGGGCTTGGTTCATCATCTCAGTACTCGAGTACTGAGATGATGAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-412s21c1
Sequence:CCGGGATAATGTTCGACAGGGACAACTCGAGTTGTCCCTGTCGAACATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-346s21c1
Sequence:CCGGCATCTGCAATATGCGCTGCAACTCGAGTTGCAGCGCATATTGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-587s21c1
Sequence:CCGGCCTTGGGTCCATATTACCCTACTCGAGTAGGGTAATATGGACCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-349s1c1
Sequence:CCGGCATCTGCAATATGCGCTGCAACTCGAGTTGCAGCGCATATTGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-1194s1c1
Sequence:CCGGGCTTGGTTCATCATCTCAGTACTCGAGTACTGAGATGATGAACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-590s1c1
Sequence:CCGGCCTTGGGTCCATATTACCCTACTCGAGTAGGGTAATATGGACCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-415s1c1
Sequence:CCGGGATAATGTTCGACAGGGACAACTCGAGTTGTCCCTGTCGAACATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172582
COQ6 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q6 monooxygenase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-1191s21c1
Sequence:CCGGGCTTGGTTCATCATCTCAGTACTCGAGTACTGAGATGATGAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-412s21c1
Sequence:CCGGGATAATGTTCGACAGGGACAACTCGAGTTGTCCCTGTCGAACATTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-346s21c1
Sequence:CCGGCATCTGCAATATGCGCTGCAACTCGAGTTGCAGCGCATATTGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172582.2-587s21c1
Sequence:CCGGCCTTGGGTCCATATTACCCTACTCGAGTAGGGTAATATGGACCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-349s1c1
Sequence:CCGGCATCTGCAATATGCGCTGCAACTCGAGTTGCAGCGCATATTGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-1194s1c1
Sequence:CCGGGCTTGGTTCATCATCTCAGTACTCGAGTACTGAGATGATGAACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-590s1c1
Sequence:CCGGCCTTGGGTCCATATTACCCTACTCGAGTAGGGTAATATGGACCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172582.1-415s1c1
Sequence:CCGGGATAATGTTCGACAGGGACAACTCGAGTTGTCCCTGTCGAACATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182476
VALIDATED
COQ6 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q6 monooxygenase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-395s1c1
Sequence:CCGGCCATATCTGCAACATGAGATACTCGAGTATCTCATGTTGCAGATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1300s1c1
Sequence:CCGGGCCACCTCACAGGTTATGAAACTCGAGTTTCATAACCTGTGAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1446s1c1
Sequence:CCGGTCTCCACTCAAAGAACAGATTCTCGAGAATCTGTTCTTTGAGTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1269s1c1
Sequence:CCGGGCCTTCAATGGGAAGGACTTACTCGAGTAAGTCCTTCCCATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182476.1-239s1c1
Sequence:CCGGCTTGGGATATGATATTCACTTCTCGAGAAGTGAATATCATATCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182476
VALIDATED
COQ6 MISSION shRNA shRNA Plasmid DNA
coenzyme Q6 monooxygenase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-395s1c1
Sequence:CCGGCCATATCTGCAACATGAGATACTCGAGTATCTCATGTTGCAGATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1300s1c1
Sequence:CCGGGCCACCTCACAGGTTATGAAACTCGAGTTTCATAACCTGTGAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1446s1c1
Sequence:CCGGTCTCCACTCAAAGAACAGATTCTCGAGAATCTGTTCTTTGAGTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1269s1c1
Sequence:CCGGGCCTTCAATGGGAAGGACTTACTCGAGTAAGTCCTTCCCATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182476.1-239s1c1
Sequence:CCGGCTTGGGATATGATATTCACTTCTCGAGAAGTGAATATCATATCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182476
VALIDATED
COQ6 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q6 monooxygenase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-395s1c1
Sequence:CCGGCCATATCTGCAACATGAGATACTCGAGTATCTCATGTTGCAGATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1300s1c1
Sequence:CCGGGCCACCTCACAGGTTATGAAACTCGAGTTTCATAACCTGTGAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1446s1c1
Sequence:CCGGTCTCCACTCAAAGAACAGATTCTCGAGAATCTGTTCTTTGAGTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_182476.1-1269s1c1
Sequence:CCGGGCCTTCAATGGGAAGGACTTACTCGAGTAAGTCCTTCCCATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182476.1-239s1c1
Sequence:CCGGCTTGGGATATGATATTCACTTCTCGAGAAGTGAATATCATATCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)