EMAIL THIS PAGE TO A FRIEND

COQ7

coenzyme Q7 homolog, ubiquinone (yeast)

Synonyms: CAT5 CLK-1 CLK1
UniProtKB ID: Q99807, B2RDA9, Q9BTT7, Q9H0T5, Q9UEW5, Q9UNR5
Gene ID:
Human(10229) Summary: The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(12850) demethyl-Q 7
Rat(25249) coenzyme Q7 homolog, ubiquinone (yeast)
sheep(101116112) coenzyme Q7 homolog, ubiquinone (yeast)
naked mole-rat(101700328) coenzyme Q7 homolog, ubiquinone (yeast)
domestic guinea pig(100735871) coenzyme Q7 homolog, ubiquinone (yeast)
fruit fly(44007) CG14437 gene product from transcript CG14437-RA
chicken(416609) coenzyme Q7 homolog, ubiquinone (yeast)
dog(479828) coenzyme Q7 homolog, ubiquinone (yeast)
cow(504771) coenzyme Q7 homolog, ubiquinone (yeast)
domestic cat(101085941) coenzyme Q7 homolog, ubiquinone (yeast)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016138 Rosetta Predictions human pricing
NM_012785 Rosetta Predictions rat pricing
NM_009940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137864 predicted 588
2 SASI_Hs01_00137865 predicted 603
3 SASI_Hs01_00137866 predicted 545
4 SASI_Hs01_00137867 predicted 549
5 SASI_Hs01_00137868 predicted 546
6 SASI_Hs01_00137870 predicted 380
7 SASI_Hs01_00137871 predicted 354
8 SASI_Hs01_00137872 predicted 485
9 SASI_Hs01_00137873 predicted 487
10 SASI_Hs02_00348933 predicted 608
11 SASI_Hs01_00137869 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118156 predicted 391
2 SASI_Rn02_00260191 predicted 376
3 SASI_Rn01_00118157 predicted 457
4 SASI_Rn02_00260192 predicted 458
5 SASI_Rn01_00118158 predicted 464
6 SASI_Rn01_00118159 predicted 314
7 SASI_Rn01_00118160 predicted 309
8 SASI_Rn01_00118161 predicted 313
9 SASI_Rn01_00118162 predicted 459
10 SASI_Rn01_00118163 predicted 468
11 SASI_Rn01_00118164 predicted 294
12 SASI_Rn01_00118165 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317496 predicted 216
2 SASI_Mm01_00033487 predicted 473
3 SASI_Mm01_00033488 predicted 247
4 SASI_Mm01_00033489 predicted 478
5 SASI_Mm01_00033491 predicted 347
6 SASI_Mm01_00033492 predicted 287
7 SASI_Mm01_00033493 predicted 217
8 SASI_Mm01_00033494 predicted 287
9 SASI_Mm01_00033495 predicted 251
10 SASI_Mm01_00033496 predicted 242
11 SASI_Mm01_00033490 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016138
VALIDATED
COQ7 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q7 homolog, ubiquinone (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016138.3-170s1c1
Sequence:CCGGCAGGAATGACTTTAGACAATACTCGAGTATTGTCTAAAGTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-208s1c1
Sequence:CCGGGATCGAATAATCCGGGTGGATCTCGAGATCCACCCGGATTATTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-351s1c1
Sequence:CCGGCAATGAGTTGATGGTTACGTTCTCGAGAACGTAACCATCAACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-1551s1c1
Sequence:CCGGCGATGAAATCTTCACTCTCAACTCGAGTTGAGAGTGAAGATTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016138.3-351s21c1
Sequence:CCGGCAATGAGTTGATGGTTACGTTCTCGAGAACGTAACCATCAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016138.3-1889s21c1
Sequence:CCGGGTACTAAGTTGTGGATTATTTCTCGAGAAATAATCCACAACTTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-676s21c1
Sequence:CCGGGGATGCAGAGTGGCGATATATCTCGAGATATATCGCCACTCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-648s21c1
Sequence:CCGGTGCCGTCCTGAAGAGCATTATCTCGAGATAATGCTCTTCAGGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-223s21c1
Sequence:CCGGGTGGATCATGCAGGCGAATATCTCGAGATATTCGCCTGCATGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-198s21c1
Sequence:CCGGGGCAGCTGTGGATCGAATAATCTCGAGATTATTCGATCCACAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016138
VALIDATED
COQ7 MISSION shRNA shRNA Plasmid DNA
coenzyme Q7 homolog, ubiquinone (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016138.3-170s1c1
Sequence:CCGGCAGGAATGACTTTAGACAATACTCGAGTATTGTCTAAAGTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-208s1c1
Sequence:CCGGGATCGAATAATCCGGGTGGATCTCGAGATCCACCCGGATTATTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-351s1c1
Sequence:CCGGCAATGAGTTGATGGTTACGTTCTCGAGAACGTAACCATCAACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-1551s1c1
Sequence:CCGGCGATGAAATCTTCACTCTCAACTCGAGTTGAGAGTGAAGATTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016138.3-351s21c1
Sequence:CCGGCAATGAGTTGATGGTTACGTTCTCGAGAACGTAACCATCAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016138.3-1889s21c1
Sequence:CCGGGTACTAAGTTGTGGATTATTTCTCGAGAAATAATCCACAACTTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-676s21c1
Sequence:CCGGGGATGCAGAGTGGCGATATATCTCGAGATATATCGCCACTCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-648s21c1
Sequence:CCGGTGCCGTCCTGAAGAGCATTATCTCGAGATAATGCTCTTCAGGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-223s21c1
Sequence:CCGGGTGGATCATGCAGGCGAATATCTCGAGATATTCGCCTGCATGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-198s21c1
Sequence:CCGGGGCAGCTGTGGATCGAATAATCTCGAGATTATTCGATCCACAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016138
VALIDATED
COQ7 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q7 homolog, ubiquinone (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016138.3-170s1c1
Sequence:CCGGCAGGAATGACTTTAGACAATACTCGAGTATTGTCTAAAGTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-208s1c1
Sequence:CCGGGATCGAATAATCCGGGTGGATCTCGAGATCCACCCGGATTATTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-351s1c1
Sequence:CCGGCAATGAGTTGATGGTTACGTTCTCGAGAACGTAACCATCAACTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146644    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_016138.3-1551s1c1
Sequence:CCGGCGATGAAATCTTCACTCTCAACTCGAGTTGAGAGTGAAGATTTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016138.3-351s21c1
Sequence:CCGGCAATGAGTTGATGGTTACGTTCTCGAGAACGTAACCATCAACTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016138.3-1889s21c1
Sequence:CCGGGTACTAAGTTGTGGATTATTTCTCGAGAAATAATCCACAACTTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-676s21c1
Sequence:CCGGGGATGCAGAGTGGCGATATATCTCGAGATATATCGCCACTCTGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-648s21c1
Sequence:CCGGTGCCGTCCTGAAGAGCATTATCTCGAGATAATGCTCTTCAGGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-223s21c1
Sequence:CCGGGTGGATCATGCAGGCGAATATCTCGAGATATTCGCCTGCATGATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016138.3-198s21c1
Sequence:CCGGGGCAGCTGTGGATCGAATAATCTCGAGATTATTCGATCCACAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009940
VALIDATED
COQ7 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q7 homolog, ubiquinone (yeast)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.1-214s1c1
Sequence:CCGGGATCGAATAATTCGGGTGGATCTCGAGATCCACCCGAATTATTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-200s21c1
Sequence:CCGGGGCAGCCGTGGATCGAATAATCTCGAGATTATTCGATCCACGGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-651s21c1
Sequence:CCGGGCCTTGTTGAAGAGGATTATCCTCGAGGATAATCCTCTTCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-483s21c1
Sequence:CCGGGTAGAAGAGTCTATCGCTAATCTCGAGATTAGCGATAGACTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009940.2-176s21c1
Sequence:CCGGGATGACCTTAGACAATATTAACTCGAGTTAATATTGTCTAAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-679s21c1
Sequence:CCGGGATGCAGTGCAGCCATATATTCTCGAGAATATATGGCTGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.2-483s1c1
Sequence:CCGGGTAGAAGAGTCTATCGCTAATCTCGAGATTAGCGATAGACTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.2-353s1c1
Sequence:CCGGCAACGAGTTGATGATTGCATTCTCGAGAATGCAATCATCAACTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009940
VALIDATED
COQ7 MISSION shRNA shRNA Plasmid DNA
coenzyme Q7 homolog, ubiquinone (yeast)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.1-214s1c1
Sequence:CCGGGATCGAATAATTCGGGTGGATCTCGAGATCCACCCGAATTATTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-200s21c1
Sequence:CCGGGGCAGCCGTGGATCGAATAATCTCGAGATTATTCGATCCACGGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-651s21c1
Sequence:CCGGGCCTTGTTGAAGAGGATTATCCTCGAGGATAATCCTCTTCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-483s21c1
Sequence:CCGGGTAGAAGAGTCTATCGCTAATCTCGAGATTAGCGATAGACTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009940.2-176s21c1
Sequence:CCGGGATGACCTTAGACAATATTAACTCGAGTTAATATTGTCTAAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-679s21c1
Sequence:CCGGGATGCAGTGCAGCCATATATTCTCGAGAATATATGGCTGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.2-483s1c1
Sequence:CCGGGTAGAAGAGTCTATCGCTAATCTCGAGATTAGCGATAGACTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.2-353s1c1
Sequence:CCGGCAACGAGTTGATGATTGCATTCTCGAGAATGCAATCATCAACTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009940
VALIDATED
COQ7 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q7 homolog, ubiquinone (yeast)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201853    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.1-214s1c1
Sequence:CCGGGATCGAATAATTCGGGTGGATCTCGAGATCCACCCGAATTATTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-200s21c1
Sequence:CCGGGGCAGCCGTGGATCGAATAATCTCGAGATTATTCGATCCACGGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-651s21c1
Sequence:CCGGGCCTTGTTGAAGAGGATTATCCTCGAGGATAATCCTCTTCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-483s21c1
Sequence:CCGGGTAGAAGAGTCTATCGCTAATCTCGAGATTAGCGATAGACTCTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009940.2-176s21c1
Sequence:CCGGGATGACCTTAGACAATATTAACTCGAGTTAATATTGTCTAAGGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009940.2-679s21c1
Sequence:CCGGGATGCAGTGCAGCCATATATTCTCGAGAATATATGGCTGCACTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215624    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.2-483s1c1
Sequence:CCGGGTAGAAGAGTCTATCGCTAATCTCGAGATTAGCGATAGACTCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009940.2-353s1c1
Sequence:CCGGCAACGAGTTGATGATTGCATTCTCGAGAATGCAATCATCAACTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks