EMAIL THIS PAGE TO A FRIEND

COQ9

coenzyme Q9 homolog (S. cerevisiae)

48 Gene Product Result for
Synonyms: C16orf49 COQ10D5
Gene ID:
Human(57017) Summary: This locus represents a mitochondrial ubiquinone biosynthesis gene. The encoded protein is likely necessary for biosynthesis of coenzyme Q10, as mutations at this locus have been associated with autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency.[provided by RefSeq, Sep 2010]
Mouse(67914) coenzyme Q9 homolog (yeast)
Rat(498909) coenzyme Q9 homolog (S. cerevisiae)
Zebrafish(567716) coenzyme Q9 homolog (S. cerevisiae)
cow(529282) coenzyme Q9 homolog (S. cerevisiae)
chicken(415636) coenzyme Q9 homolog (S. cerevisiae)
domestic cat(101085513) coenzyme Q9 homolog (S. cerevisiae)
dog(478110) coenzyme Q9 homolog (S. cerevisiae)
domestic guinea pig(100723374) coenzyme Q9 homolog (S. cerevisiae)
naked mole-rat(101710528) coenzyme Q9 homolog (S. cerevisiae)
sheep(101123654) coenzyme Q9 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020312 Rosetta Predictions human pricing
NM_001035257 Rosetta Predictions rat pricing
NM_026452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188531 predicted 226
2 SASI_Hs01_00188532 predicted 1105
3 SASI_Hs01_00188534 predicted 866
4 SASI_Hs01_00188535 predicted 1010
5 SASI_Hs01_00188536 predicted 982
6 SASI_Hs01_00188537 predicted 1284
7 SASI_Hs01_00188538 predicted 475
8 SASI_Hs01_00188539 predicted 557
9 SASI_Hs01_00188540 predicted 1000
10 SASI_Hs02_00353227 predicted 920
11 SASI_Hs01_00188533 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101383 predicted 817
2 SASI_Rn01_00101384 predicted 425
3 SASI_Rn01_00101385 predicted 1317
4 SASI_Rn01_00101386 predicted 1010
5 SASI_Rn01_00101387 predicted 977
6 SASI_Rn01_00101388 predicted 1410
7 SASI_Rn01_00101389 predicted 1301
8 SASI_Rn01_00101390 predicted 1075
9 SASI_Rn01_00101391 predicted 988
10 SASI_Rn01_00101392 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024804 predicted 429
2 SASI_Mm01_00024802 predicted 1007
3 SASI_Mm01_00024803 predicted 811
4 SASI_Mm01_00024805 predicted 1011
5 SASI_Mm01_00024806 predicted 1035
6 SASI_Mm01_00024810 predicted 1387
7 SASI_Mm01_00024809 predicted 1197
8 SASI_Mm01_00024811 predicted 811
9 SASI_Mm02_00330291 predicted 981
10 SASI_Mm02_00330292 predicted 1257
11 SASI_Mm01_00024807 predicted 1082
12 SASI_Mm01_00024808 predicted 998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020312
VALIDATED
COQ9 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q9 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-841s21c1
Sequence:CCGGCCGGGTTAATGATGCAATGAACTCGAGTTCATTGCATCATTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-766s21c1
Sequence:CCGGCTACAACACAACAGAGCTGGTCTCGAGACCAGCTCTGTTGTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-227s21c1
Sequence:CCGGCCTGATCCAGAGTCTTCTCATCTCGAGATGAGAAGACTCTGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020312.1-1013s21c1
Sequence:CCGGGCGGACAGATTGAAAGAGCTTCTCGAGAAGCTCTTTCAATCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-145s1c1
Sequence:CCGGGCTAAGGTCTTCAGATGAGCACTCGAGTGCTCATCTGAAGACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-1013s1c1
Sequence:CCGGGCGGACAGATTGAAAGAGCTTCTCGAGAAGCTCTTTCAATCTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-766s1c1
Sequence:CCGGCTACAACACAACAGAGCTGGTCTCGAGACCAGCTCTGTTGTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-570s1c1
Sequence:CCGGCAGTGGAAACCAGACTGAGAACTCGAGTTCTCAGTCTGGTTTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-841s1c1
Sequence:CCGGCCGGGTTAATGATGCAATGAACTCGAGTTCATTGCATCATTAACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-441s1c1
Sequence:CCGGGCAGTGAGCTAATACTGCATTCTCGAGAATGCAGTATTAGCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-292s1c1
Sequence:CCGGCTATGAAAGTGAGGAGCAGTTCTCGAGAACTGCTCCTCACTTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-227s1c1
Sequence:CCGGCCTGATCCAGAGTCTTCTCATCTCGAGATGAGAAGACTCTGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020312
VALIDATED
COQ9 MISSION shRNA shRNA Plasmid DNA
coenzyme Q9 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-841s21c1
Sequence:CCGGCCGGGTTAATGATGCAATGAACTCGAGTTCATTGCATCATTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-766s21c1
Sequence:CCGGCTACAACACAACAGAGCTGGTCTCGAGACCAGCTCTGTTGTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-227s21c1
Sequence:CCGGCCTGATCCAGAGTCTTCTCATCTCGAGATGAGAAGACTCTGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020312.1-1013s21c1
Sequence:CCGGGCGGACAGATTGAAAGAGCTTCTCGAGAAGCTCTTTCAATCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-145s1c1
Sequence:CCGGGCTAAGGTCTTCAGATGAGCACTCGAGTGCTCATCTGAAGACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-1013s1c1
Sequence:CCGGGCGGACAGATTGAAAGAGCTTCTCGAGAAGCTCTTTCAATCTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-766s1c1
Sequence:CCGGCTACAACACAACAGAGCTGGTCTCGAGACCAGCTCTGTTGTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-570s1c1
Sequence:CCGGCAGTGGAAACCAGACTGAGAACTCGAGTTCTCAGTCTGGTTTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-841s1c1
Sequence:CCGGCCGGGTTAATGATGCAATGAACTCGAGTTCATTGCATCATTAACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-441s1c1
Sequence:CCGGGCAGTGAGCTAATACTGCATTCTCGAGAATGCAGTATTAGCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-292s1c1
Sequence:CCGGCTATGAAAGTGAGGAGCAGTTCTCGAGAACTGCTCCTCACTTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-227s1c1
Sequence:CCGGCCTGATCCAGAGTCTTCTCATCTCGAGATGAGAAGACTCTGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020312
VALIDATED
COQ9 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q9 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-841s21c1
Sequence:CCGGCCGGGTTAATGATGCAATGAACTCGAGTTCATTGCATCATTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-766s21c1
Sequence:CCGGCTACAACACAACAGAGCTGGTCTCGAGACCAGCTCTGTTGTGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020312.1-227s21c1
Sequence:CCGGCCTGATCCAGAGTCTTCTCATCTCGAGATGAGAAGACTCTGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020312.1-1013s21c1
Sequence:CCGGGCGGACAGATTGAAAGAGCTTCTCGAGAAGCTCTTTCAATCTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-145s1c1
Sequence:CCGGGCTAAGGTCTTCAGATGAGCACTCGAGTGCTCATCTGAAGACCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-1013s1c1
Sequence:CCGGGCGGACAGATTGAAAGAGCTTCTCGAGAAGCTCTTTCAATCTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-766s1c1
Sequence:CCGGCTACAACACAACAGAGCTGGTCTCGAGACCAGCTCTGTTGTGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-570s1c1
Sequence:CCGGCAGTGGAAACCAGACTGAGAACTCGAGTTCTCAGTCTGGTTTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-841s1c1
Sequence:CCGGCCGGGTTAATGATGCAATGAACTCGAGTTCATTGCATCATTAACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-441s1c1
Sequence:CCGGGCAGTGAGCTAATACTGCATTCTCGAGAATGCAGTATTAGCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136378    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020312.1-292s1c1
Sequence:CCGGCTATGAAAGTGAGGAGCAGTTCTCGAGAACTGCTCCTCACTTTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020312.1-227s1c1
Sequence:CCGGCCTGATCCAGAGTCTTCTCATCTCGAGATGAGAAGACTCTGGATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026452
VALIDATED
COQ9 MISSION shRNA Bacterial Glycerol Stock
coenzyme Q9 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026452.1-411s1c1
Sequence:CCGGGATGGCAGTGAGCTGATTCTTCTCGAGAAGAATCAGCTCACTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026452.1-914s1c1
Sequence:CCGGCAAGAACCTGACGGGTCTAAACTCGAGTTTAGACCCGTCAGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026452.1-512s1c1
Sequence:CCGGGAAGAGGAAGACAGACCAGTTCTCGAGAACTGGTCTGTCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026452.1-1010s1c1
Sequence:CCGGCCACCCATTGAACAGGATGTTCTCGAGAACATCCTGTTCAATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026452.1-785s1c1
Sequence:CCGGCTTTGAAGATACTTGGCGCTTCTCGAGAAGCGCCAAGTATCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026452
VALIDATED
COQ9 MISSION shRNA shRNA Plasmid DNA
coenzyme Q9 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026452.1-411s1c1
Sequence:CCGGGATGGCAGTGAGCTGATTCTTCTCGAGAAGAATCAGCTCACTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026452.1-914s1c1
Sequence:CCGGCAAGAACCTGACGGGTCTAAACTCGAGTTTAGACCCGTCAGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026452.1-512s1c1
Sequence:CCGGGAAGAGGAAGACAGACCAGTTCTCGAGAACTGGTCTGTCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026452.1-1010s1c1
Sequence:CCGGCCACCCATTGAACAGGATGTTCTCGAGAACATCCTGTTCAATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026452.1-785s1c1
Sequence:CCGGCTTTGAAGATACTTGGCGCTTCTCGAGAAGCGCCAAGTATCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026452
VALIDATED
COQ9 MISSION shRNA Lentiviral Transduction Particles
coenzyme Q9 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026452.1-411s1c1
Sequence:CCGGGATGGCAGTGAGCTGATTCTTCTCGAGAAGAATCAGCTCACTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026452.1-914s1c1
Sequence:CCGGCAAGAACCTGACGGGTCTAAACTCGAGTTTAGACCCGTCAGGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026452.1-512s1c1
Sequence:CCGGGAAGAGGAAGACAGACCAGTTCTCGAGAACTGGTCTGTCTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026452.1-1010s1c1
Sequence:CCGGCCACCCATTGAACAGGATGTTCTCGAGAACATCCTGTTCAATGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026452.1-785s1c1
Sequence:CCGGCTTTGAAGATACTTGGCGCTTCTCGAGAAGCGCCAAGTATCTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks