EMAIL THIS PAGE TO A FRIEND

CORIN

corin, serine peptidase

161 Gene Product Result for
Synonyms: ATC2 CRN Lrp4 PEE5 TMPRSS10
UniProtKB ID: Q9Y5Q5, B0ZBE3, Q2TBD2, Q4W5E5, Q4W5G6, Q9UHY2
Gene ID:
Human(10699) Summary: This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Mouse(53419) corin
Rat(289596) corin, serine peptidase
fruit fly(35691) CG2105 gene product from transcript CG2105-RC
cow(527107) corin, serine peptidase
Horse(100054484) corin, serine peptidase
domestic cat(101096889) corin, serine peptidase
dog(482135) corin, serine peptidase
chicken(100857733) corin, serine peptidase
domestic guinea pig(100720071) corin, serine peptidase
naked mole-rat(101715574) corin, serine peptidase
sheep(101112571) corin, serine peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006587 Rosetta Predictions human pricing
NM_182473 Rosetta Predictions rat pricing
NM_001122756 Rosetta Predictions mouse pricing
NM_016869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341888 predicted 2544
2 SASI_Hs02_00341889 predicted 1935
3 SASI_Hs01_00162996 predicted 2632
4 SASI_Hs01_00162997 predicted 995
5 SASI_Hs02_00341890 predicted 1461
6 SASI_Hs01_00163000 predicted 1420
7 SASI_Hs01_00163001 predicted 648
8 SASI_Hs01_00163002 predicted 1492
9 SASI_Hs01_00163003 predicted 3007
10 SASI_Hs01_00163004 predicted 206
11 SASI_Hs01_00162998 predicted 1336
12 SASI_Hs01_00162999 predicted 2598
13 SASI_Hs01_00163005 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269809 predicted 1234
2 SASI_Rn01_00059465 predicted 428
3 SASI_Rn01_00059466 predicted 1620
4 SASI_Rn01_00059467 predicted 1953
5 SASI_Rn01_00059468 predicted 2410
6 SASI_Rn01_00059469 predicted 340
7 SASI_Rn01_00059470 predicted 2090
8 SASI_Rn01_00059471 predicted 1009
9 SASI_Rn01_00059472 predicted 2057
10 SASI_Rn01_00059473 predicted 478
11 SASI_Rn01_00059464 predicted 2936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309351 predicted 3187
2 SASI_Mm02_00309352 predicted 2861
3 SASI_Mm02_00309353 predicted 836
4 SASI_Mm02_00309354 predicted 1590
5 SASI_Mm02_00309355 predicted 1056
6 SASI_Mm02_00309356 predicted 390
7 SASI_Mm02_00309357 predicted 1835
8 SASI_Mm02_00309358 predicted 658
9 SASI_Mm02_00309359 predicted 1950
10 SASI_Mm02_00309360 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120837 predicted 3337
2 SASI_Mm02_00323661 predicted 3021
3 SASI_Mm01_00120838 predicted 995
4 SASI_Mm01_00120839 predicted 1744
5 SASI_Mm02_00323662 predicted 1219
6 SASI_Mm01_00120840 predicted 546
7 SASI_Mm01_00120841 predicted 1985
8 SASI_Mm01_00120842 predicted 812
9 SASI_Mm01_00120844 predicted 2103
10 SASI_Mm01_00120845 predicted 1379
11 SASI_Mm01_00120843 predicted 383
12 SASI_Mm01_00120846 predicted 1948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006587
CORIN MISSION shRNA Bacterial Glycerol Stock
corin, serine peptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006587.2-4071s1c1
Sequence:CCGGGCTGGGTTTGTTCAGGATATACTCGAGTATATCCTGAACAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-812s1c1
Sequence:CCGGGCTCCCAGTTTAGAAACCAAACTCGAGTTTGGTTTCTAAACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-3082s1c1
Sequence:CCGGCGGTGGACATTATTTGGATTACTCGAGTAATCCAAATAATGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-633s1c1
Sequence:CCGGCCTCAGTTGCTATCAACATATCTCGAGATATGTTGATAGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-943s1c1
Sequence:CCGGCCCGGGAAACTGCAATGTAATCTCGAGATTACATTGCAGTTTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2856s21c1
Sequence:CCGGGCCTGACACGTACTGCTATATCTCGAGATATAGCAGTACGTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2923s21c1
Sequence:CCGGGAGGGAGAGGTCCGCATTATTCTCGAGAATAATGCGGACCTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2981s21c1
Sequence:CCGGCCATCACCACTCGGATGATATCTCGAGATATCATCCGAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006587
CORIN MISSION shRNA shRNA Plasmid DNA
corin, serine peptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006587.2-4071s1c1
Sequence:CCGGGCTGGGTTTGTTCAGGATATACTCGAGTATATCCTGAACAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-812s1c1
Sequence:CCGGGCTCCCAGTTTAGAAACCAAACTCGAGTTTGGTTTCTAAACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-3082s1c1
Sequence:CCGGCGGTGGACATTATTTGGATTACTCGAGTAATCCAAATAATGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-633s1c1
Sequence:CCGGCCTCAGTTGCTATCAACATATCTCGAGATATGTTGATAGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-943s1c1
Sequence:CCGGCCCGGGAAACTGCAATGTAATCTCGAGATTACATTGCAGTTTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2856s21c1
Sequence:CCGGGCCTGACACGTACTGCTATATCTCGAGATATAGCAGTACGTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2923s21c1
Sequence:CCGGGAGGGAGAGGTCCGCATTATTCTCGAGAATAATGCGGACCTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2981s21c1
Sequence:CCGGCCATCACCACTCGGATGATATCTCGAGATATCATCCGAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006587
CORIN MISSION shRNA Lentiviral Transduction Particles
corin, serine peptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006587.2-4071s1c1
Sequence:CCGGGCTGGGTTTGTTCAGGATATACTCGAGTATATCCTGAACAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-812s1c1
Sequence:CCGGGCTCCCAGTTTAGAAACCAAACTCGAGTTTGGTTTCTAAACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-3082s1c1
Sequence:CCGGCGGTGGACATTATTTGGATTACTCGAGTAATCCAAATAATGTCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-633s1c1
Sequence:CCGGCCTCAGTTGCTATCAACATATCTCGAGATATGTTGATAGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006587.2-943s1c1
Sequence:CCGGCCCGGGAAACTGCAATGTAATCTCGAGATTACATTGCAGTTTCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2856s21c1
Sequence:CCGGGCCTGACACGTACTGCTATATCTCGAGATATAGCAGTACGTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2923s21c1
Sequence:CCGGGAGGGAGAGGTCCGCATTATTCTCGAGAATAATGCGGACCTCTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006587.2-2981s21c1
Sequence:CCGGCCATCACCACTCGGATGATATCTCGAGATATCATCCGAGTGGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016869
CORIN MISSION shRNA Bacterial Glycerol Stock
corin, serine peptidase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016869.1-4049s1c1
Sequence:CCGGCCACCAGATTTGTTCCCGTTACTCGAGTAACGGGAACAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-2094s1c1
Sequence:CCGGCGAGGAGAACTGTGGTTGTAACTCGAGTTACAACCACAGTTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-3243s1c1
Sequence:CCGGCGGAGGACAGTGGACATTATTCTCGAGAATAATGTCCACTGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-2228s1c1
Sequence:CCGGGCCAAGACAATGAGCTGGAATCTCGAGATTCCAGCTCATTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-799s1c1
Sequence:CCGGCGCCTCAGTTGCTATCAACATCTCGAGATGTTGATAGCAACTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-1923s21c1
Sequence:CCGGAGACACCGACTGCAATCAATTCTCGAGAATTGATTGCAGTCGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-1124s21c1
Sequence:CCGGTGCAGTGTAACGGCTATAATGCTCGAGCATTATAGCCGTTACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-886s21c1
Sequence:CCGGCTTCTACCCTGTAGATCTTTCCTCGAGGAAAGATCTACAGGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016869
CORIN MISSION shRNA shRNA Plasmid DNA
corin, serine peptidase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016869.1-4049s1c1
Sequence:CCGGCCACCAGATTTGTTCCCGTTACTCGAGTAACGGGAACAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-2094s1c1
Sequence:CCGGCGAGGAGAACTGTGGTTGTAACTCGAGTTACAACCACAGTTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-3243s1c1
Sequence:CCGGCGGAGGACAGTGGACATTATTCTCGAGAATAATGTCCACTGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-2228s1c1
Sequence:CCGGGCCAAGACAATGAGCTGGAATCTCGAGATTCCAGCTCATTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-799s1c1
Sequence:CCGGCGCCTCAGTTGCTATCAACATCTCGAGATGTTGATAGCAACTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-1923s21c1
Sequence:CCGGAGACACCGACTGCAATCAATTCTCGAGAATTGATTGCAGTCGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-1124s21c1
Sequence:CCGGTGCAGTGTAACGGCTATAATGCTCGAGCATTATAGCCGTTACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-886s21c1
Sequence:CCGGCTTCTACCCTGTAGATCTTTCCTCGAGGAAAGATCTACAGGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016869
CORIN MISSION shRNA Lentiviral Transduction Particles
corin, serine peptidase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016869.1-4049s1c1
Sequence:CCGGCCACCAGATTTGTTCCCGTTACTCGAGTAACGGGAACAAATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-2094s1c1
Sequence:CCGGCGAGGAGAACTGTGGTTGTAACTCGAGTTACAACCACAGTTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-3243s1c1
Sequence:CCGGCGGAGGACAGTGGACATTATTCTCGAGAATAATGTCCACTGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-2228s1c1
Sequence:CCGGGCCAAGACAATGAGCTGGAATCTCGAGATTCCAGCTCATTGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016869.1-799s1c1
Sequence:CCGGCGCCTCAGTTGCTATCAACATCTCGAGATGTTGATAGCAACTGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-1923s21c1
Sequence:CCGGAGACACCGACTGCAATCAATTCTCGAGAATTGATTGCAGTCGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-1124s21c1
Sequence:CCGGTGCAGTGTAACGGCTATAATGCTCGAGCATTATAGCCGTTACACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016869.3-886s21c1
Sequence:CCGGCTTCTACCCTGTAGATCTTTCCTCGAGGAAAGATCTACAGGGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks