EMAIL THIS PAGE TO A FRIEND

CORO1A

coronin, actin binding protein, 1A

60 Gene Product Result for
Synonyms: CLABP CLIPINA HCORO1 IMD8 TACO p57
UniProtKB ID: P31146, B2RBL1, Q2YD73
Gene ID:
Human(11151) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. A related pseudogene has been defined on chromosome 16. [provided by RefSeq, Sep 2010]
Mouse(12721) coronin, actin binding protein 1A
Rat(155151) coronin, actin binding protein 1A
Zebrafish(100002113) coronin, actin binding protein, 1A
dog(489949) coronin, actin binding protein, 1A
cow(282196) coronin, actin binding protein, 1A
Horse(100064170) coronin, actin binding protein, 1A
domestic cat(101081104) coronin, actin binding protein, 1A
sheep(101114326) coronin, actin binding protein, 1A
Domestic Rabbit(100008706) coronin, actin binding protein, 1A
naked mole-rat(101726306) coronin, actin binding protein, 1A
domestic guinea pig(100725425) coronin, actin binding protein, 1A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34285 Anti-CORO1A (AB1) antibody produced in rabbit IgG fraction of antiserum horse, rabbit, bovine, guinea pig, mouse, rat, rabbit, canine, human
western blot pricing
AV38899 Anti-CORO1A (AB2) antibody produced in rabbit IgG fraction of antiserum , human, bovine, rabbit, guinea pig, rabbit, canine, zebrafish, mouse, rat, horse
western blot pricing
AV38900 Anti-CORO1A (AB3) antibody produced in rabbit IgG fraction of antiserum rabbit, rat, horse, human, rabbit, mouse, canine, bovine
western blot pricing
AV34286 Anti-CORO1A antibody produced in rabbit affinity isolated antibody human, rabbit, rat, mouse, horse, guinea pig, canine, bovine
western blot pricing
HPA051132 Anti-CORO1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2500263 Anti-Coronin 1/TACO antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4200078 Anti-Coronin-1A (N-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody mouse, human, rat
western blot pricing
SAB4200077 Anti-Coronin-1C (C-terminal) ~1.5 mg/mL, affinity isolated antibody rat, mouse, human
western blot pricing
WH0011151M1 Monoclonal Anti-CORO1A antibody produced in mouse clone 4G10, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB1404910 Monoclonal Anti-CORO1A, (C-terminal) antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007074 Rosetta Predictions human pricing
NM_130411 Rosetta Predictions rat pricing
NM_009898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246297 predicted 386
2 SASI_Hs01_00246298 predicted 1029
3 SASI_Hs01_00246300 predicted 1160
4 SASI_Hs01_00246301 predicted 946
5 SASI_Hs01_00246302 predicted 1162
6 SASI_Hs01_00246303 predicted 504
7 SASI_Hs01_00246304 predicted 677
8 SASI_Hs01_00246305 predicted 669
9 SASI_Hs01_00246306 predicted 647
10 SASI_Hs02_00342902 predicted 976
11 SASI_Hs01_00246299 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045053 predicted 1148
2 SASI_Rn02_00267405 predicted 400
3 SASI_Rn02_00267406 predicted 1149
4 SASI_Rn01_00045054 predicted 963
5 SASI_Rn01_00045055 predicted 929
6 SASI_Rn01_00045056 predicted 289
7 SASI_Rn01_00045057 predicted 684
8 SASI_Rn01_00045058 predicted 1129
9 SASI_Rn01_00045059 predicted 611
10 SASI_Rn01_00045061 predicted 1327
11 SASI_Rn01_00045060 predicted 421
12 SASI_Rn01_00045062 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172710 predicted 965
2 SASI_Mm01_00172711 predicted 611
3 SASI_Mm01_00172712 predicted 291
4 SASI_Mm01_00172713 predicted 551
5 SASI_Mm01_00172714 predicted 1323
6 SASI_Mm02_00317400 predicted 762
7 SASI_Mm01_00172715 predicted 684
8 SASI_Mm01_00172716 predicted 925
9 SASI_Mm01_00172717 predicted 410
10 SASI_Mm01_00172718 predicted 1004
11 SASI_Mm01_00172709 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009898
CORO1A MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1086s1c1
Sequence:CCGGGAAGTGAATAAGTGTGAGATTCTCGAGAATCTCACACTTATTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1013s1c1
Sequence:CCGGCCTGCATTATCTTTCCATGTTCTCGAGAACATGGAAAGATAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-800s1c1
Sequence:CCGGGAAGATTCTAACCACGGGTTTCTCGAGAAACCCGTGGTTAGAATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-968s1c1
Sequence:CCGGTGACAGCTCTATCCGGTATTTCTCGAGAAATACCGGATAGAGCTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1160s1c1
Sequence:CCGGGCCTAGAAAGTCGGACCTGTTCTCGAGAACAGGTCCGACTTTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009898
CORO1A MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1086s1c1
Sequence:CCGGGAAGTGAATAAGTGTGAGATTCTCGAGAATCTCACACTTATTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1013s1c1
Sequence:CCGGCCTGCATTATCTTTCCATGTTCTCGAGAACATGGAAAGATAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-800s1c1
Sequence:CCGGGAAGATTCTAACCACGGGTTTCTCGAGAAACCCGTGGTTAGAATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-968s1c1
Sequence:CCGGTGACAGCTCTATCCGGTATTTCTCGAGAAATACCGGATAGAGCTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1160s1c1
Sequence:CCGGGCCTAGAAAGTCGGACCTGTTCTCGAGAACAGGTCCGACTTTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009898
CORO1A MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1086s1c1
Sequence:CCGGGAAGTGAATAAGTGTGAGATTCTCGAGAATCTCACACTTATTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1013s1c1
Sequence:CCGGCCTGCATTATCTTTCCATGTTCTCGAGAACATGGAAAGATAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-800s1c1
Sequence:CCGGGAAGATTCTAACCACGGGTTTCTCGAGAAACCCGTGGTTAGAATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-968s1c1
Sequence:CCGGTGACAGCTCTATCCGGTATTTCTCGAGAAATACCGGATAGAGCTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009898.2-1160s1c1
Sequence:CCGGGCCTAGAAAGTCGGACCTGTTCTCGAGAACAGGTCCGACTTTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007074
CORO1A MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 1A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-371s1c1
Sequence:CCGGCCGCACAATGACAACGTCATTCTCGAGAATGACGTTGTCATTGTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-654s1c1
Sequence:CCGGGCCGAGATGGAGGCCTCATTTCTCGAGAAATGAGGCCTCCATCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-217s1c1
Sequence:CCGGCTGTGCTGTCAACCCTAAGTTCTCGAGAACTTAGGGTTGACAGCACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-965s1c1
Sequence:CCGGGACAGCTCAATCCGGTACTTTCTCGAGAAAGTACCGGATTGAGCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-1156s1c1
Sequence:CCGGGCCTCGAAAGTCGGACCTGTTCTCGAGAACAGGTCCGACTTTCGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007074
CORO1A MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 1A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-371s1c1
Sequence:CCGGCCGCACAATGACAACGTCATTCTCGAGAATGACGTTGTCATTGTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-654s1c1
Sequence:CCGGGCCGAGATGGAGGCCTCATTTCTCGAGAAATGAGGCCTCCATCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-217s1c1
Sequence:CCGGCTGTGCTGTCAACCCTAAGTTCTCGAGAACTTAGGGTTGACAGCACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-965s1c1
Sequence:CCGGGACAGCTCAATCCGGTACTTTCTCGAGAAAGTACCGGATTGAGCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-1156s1c1
Sequence:CCGGGCCTCGAAAGTCGGACCTGTTCTCGAGAACAGGTCCGACTTTCGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007074
CORO1A MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 1A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-371s1c1
Sequence:CCGGCCGCACAATGACAACGTCATTCTCGAGAATGACGTTGTCATTGTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-654s1c1
Sequence:CCGGGCCGAGATGGAGGCCTCATTTCTCGAGAAATGAGGCCTCCATCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-217s1c1
Sequence:CCGGCTGTGCTGTCAACCCTAAGTTCTCGAGAACTTAGGGTTGACAGCACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-965s1c1
Sequence:CCGGGACAGCTCAATCCGGTACTTTCTCGAGAAAGTACCGGATTGAGCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007074.1-1156s1c1
Sequence:CCGGGCCTCGAAAGTCGGACCTGTTCTCGAGAACAGGTCCGACTTTCGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)