EMAIL THIS PAGE TO A FRIEND

CORO1B

coronin, actin binding protein, 1B

67 Gene Product Result for
Synonyms: CORONIN-2
UniProtKB ID: Q9BR76, B2RD45
Gene ID:
Human(57175) Summary: Members of the coronin family, such as CORO1B, are WD repeat-containing actin-binding proteins that regulate cell motility (Cai et al., 2005 [PubMed 16027158]
Mouse(23789) coronin, actin binding protein 1B
Rat(29474) coronin, actin-binding protein, 1B
domestic guinea pig(100722709) coronin, actin binding protein, 1B
naked mole-rat(101701855) coronin, actin binding protein, 1B
sheep(101109841) coronin, actin binding protein, 1B
Domestic Rabbit(100009415) coronin, actin binding protein, 1B
Zebrafish(560168) coronin, actin binding protein, 1B
domestic cat(101092050) coronin, actin binding protein, 1B
cow(510128) coronin, actin binding protein, 1B
Horse(100053095) coronin, actin binding protein, 1B
dog(476007) coronin, actin binding protein, 1B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020441 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143371 MISSION® esiRNA esiRNA human CORO1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018070 Rosetta Predictions human pricing
NM_020441 Rosetta Predictions human pricing
NM_019222 Rosetta Predictions rat pricing
NM_011778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084499 predicted 342
2 SASI_Hs01_00084500 predicted 547
3 SASI_Hs02_00306961 predicted 997
4 SASI_Hs01_00084501 predicted 1006
5 SASI_Hs01_00084502 predicted 972
6 SASI_Hs01_00084503 predicted 1003
7 SASI_Hs01_00084504 predicted 552
8 SASI_Hs01_00084505 predicted 460
9 SASI_Hs01_00084506 predicted 621
10 SASI_Hs01_00084507 predicted 371
11 SASI_Hs01_00084508 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010141 predicted 354
2 SASI_Hs01_00010142 predicted 550
3 SASI_Hs02_00353465 predicted 1009
4 SASI_Hs01_00010143 predicted 1007
5 SASI_Hs01_00010144 predicted 981
6 SASI_Hs01_00010145 predicted 1014
7 SASI_Hs01_00010146 predicted 568
8 SASI_Hs01_00010147 predicted 467
9 SASI_Hs01_00010148 predicted 636
10 SASI_Hs01_00010149 predicted 377
11 SASI_Hs01_00010150 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075172 predicted 744
2 SASI_Rn01_00075173 predicted 1182
3 SASI_Rn01_00075174 predicted 1202
4 SASI_Rn01_00075175 predicted 892
5 SASI_Rn01_00075176 predicted 1057
6 SASI_Rn01_00075177 predicted 900
7 SASI_Rn01_00075179 predicted 734
8 SASI_Rn01_00075180 predicted 1069
9 SASI_Rn02_00262081 predicted 715
10 SASI_Rn01_00075181 predicted 1308
11 SASI_Rn01_00075178 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174661 predicted 1118
2 SASI_Mm01_00174662 predicted 1237
3 SASI_Mm01_00174663 predicted 1257
4 SASI_Mm01_00174664 predicted 1219
5 SASI_Mm01_00174665 predicted 357
6 SASI_Mm01_00174666 predicted 533
7 SASI_Mm01_00174667 predicted 769
8 SASI_Mm01_00174668 predicted 1329
9 SASI_Mm01_00174669 predicted 1080
10 SASI_Mm01_00174670 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020441
VALIDATED
CORO1B MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-1739s1c1
Sequence:CCGGCGCCCAGCTTTCCTCACTGTTCTCGAGAACAGTGAGGAAAGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-385s1c1
Sequence:CCGGCCTCACAACGACGAAGTCATACTCGAGTATGACTTCGTCGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-1114s1c1
Sequence:CCGGGCCCGGTTCTACAAACTGCATCTCGAGATGCAGTTTGTAGAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-576s1c1
Sequence:CCGGCGTGGTACTCATCTGGAATGTCTCGAGACATTCCAGATGAGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-169s1c1
Sequence:CCGGGTCAAGAACGACCAGTGCTATCTCGAGATAGCACTGGTCGTTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-385s21c1
Sequence:CCGGCCTCACAACGACGAAGTCATACTCGAGTATGACTTCGTCGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-1114s21c1
Sequence:CCGGGCCCGGTTCTACAAACTGCATCTCGAGATGCAGTTTGTAGAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-1739s21c1
Sequence:CCGGCGCCCAGCTTTCCTCACTGTTCTCGAGAACAGTGAGGAAAGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-169s21c1
Sequence:CCGGGTCAAGAACGACCAGTGCTATCTCGAGATAGCACTGGTCGTTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020441.2-576s21c1
Sequence:CCGGCGTGGTACTCATCTGGAATGTCTCGAGACATTCCAGATGAGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020441
VALIDATED
CORO1B MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-1739s1c1
Sequence:CCGGCGCCCAGCTTTCCTCACTGTTCTCGAGAACAGTGAGGAAAGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-385s1c1
Sequence:CCGGCCTCACAACGACGAAGTCATACTCGAGTATGACTTCGTCGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-1114s1c1
Sequence:CCGGGCCCGGTTCTACAAACTGCATCTCGAGATGCAGTTTGTAGAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-576s1c1
Sequence:CCGGCGTGGTACTCATCTGGAATGTCTCGAGACATTCCAGATGAGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-169s1c1
Sequence:CCGGGTCAAGAACGACCAGTGCTATCTCGAGATAGCACTGGTCGTTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-385s21c1
Sequence:CCGGCCTCACAACGACGAAGTCATACTCGAGTATGACTTCGTCGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-1114s21c1
Sequence:CCGGGCCCGGTTCTACAAACTGCATCTCGAGATGCAGTTTGTAGAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-1739s21c1
Sequence:CCGGCGCCCAGCTTTCCTCACTGTTCTCGAGAACAGTGAGGAAAGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-169s21c1
Sequence:CCGGGTCAAGAACGACCAGTGCTATCTCGAGATAGCACTGGTCGTTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020441.2-576s21c1
Sequence:CCGGCGTGGTACTCATCTGGAATGTCTCGAGACATTCCAGATGAGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020441
VALIDATED
CORO1B MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-1739s1c1
Sequence:CCGGCGCCCAGCTTTCCTCACTGTTCTCGAGAACAGTGAGGAAAGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-385s1c1
Sequence:CCGGCCTCACAACGACGAAGTCATACTCGAGTATGACTTCGTCGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-1114s1c1
Sequence:CCGGGCCCGGTTCTACAAACTGCATCTCGAGATGCAGTTTGTAGAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-576s1c1
Sequence:CCGGCGTGGTACTCATCTGGAATGTCTCGAGACATTCCAGATGAGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020441.2-169s1c1
Sequence:CCGGGTCAAGAACGACCAGTGCTATCTCGAGATAGCACTGGTCGTTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-385s21c1
Sequence:CCGGCCTCACAACGACGAAGTCATACTCGAGTATGACTTCGTCGTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-1114s21c1
Sequence:CCGGGCCCGGTTCTACAAACTGCATCTCGAGATGCAGTTTGTAGAACCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-1739s21c1
Sequence:CCGGCGCCCAGCTTTCCTCACTGTTCTCGAGAACAGTGAGGAAAGCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_020441.2-169s21c1
Sequence:CCGGGTCAAGAACGACCAGTGCTATCTCGAGATAGCACTGGTCGTTCTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020441.2-576s21c1
Sequence:CCGGCGTGGTACTCATCTGGAATGTCTCGAGACATTCCAGATGAGTACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011778
VALIDATED
CORO1B MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1139s1c1
Sequence:CCGGGCCAAGAAAGTCTGACCTCTTCTCGAGAAGAGGTCAGACTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1225s1c1
Sequence:CCGGGCGGTCAGGATGCTAATCCAACTCGAGTTGGATTAGCATCCTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011778.1-960s1c1
Sequence:CCGGCGGTACTTTGAGATCACAGATCTCGAGATCTGTGATCTCAAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1198s1c1
Sequence:CCGGCTGCTCTTGAAGCAGAGGATTCTCGAGAATCCTCTGCTTCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-987s1c1
Sequence:CCGGCCCTACATCCACTTCCTGAATCTCGAGATTCAGGAAGTGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1191s21c1
Sequence:CCGGCTGCTCTTGAAGCAGAGGATTCTCGAGAATCCTCTGCTTCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-980s21c1
Sequence:CCGGCCCTACATCCACTTCCTGAATCTCGAGATTCAGGAAGTGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1218s21c1
Sequence:CCGGGCGGTCAGGATGCTAATCCAACTCGAGTTGGATTAGCATCCTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-953s21c1
Sequence:CCGGCGGTACTTTGAGATCACAGATCTCGAGATCTGTGATCTCAAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1132s21c1
Sequence:CCGGGCCAAGAAAGTCTGACCTCTTCTCGAGAAGAGGTCAGACTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011778
VALIDATED
CORO1B MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1139s1c1
Sequence:CCGGGCCAAGAAAGTCTGACCTCTTCTCGAGAAGAGGTCAGACTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1225s1c1
Sequence:CCGGGCGGTCAGGATGCTAATCCAACTCGAGTTGGATTAGCATCCTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011778.1-960s1c1
Sequence:CCGGCGGTACTTTGAGATCACAGATCTCGAGATCTGTGATCTCAAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1198s1c1
Sequence:CCGGCTGCTCTTGAAGCAGAGGATTCTCGAGAATCCTCTGCTTCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-987s1c1
Sequence:CCGGCCCTACATCCACTTCCTGAATCTCGAGATTCAGGAAGTGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1191s21c1
Sequence:CCGGCTGCTCTTGAAGCAGAGGATTCTCGAGAATCCTCTGCTTCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-980s21c1
Sequence:CCGGCCCTACATCCACTTCCTGAATCTCGAGATTCAGGAAGTGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1218s21c1
Sequence:CCGGGCGGTCAGGATGCTAATCCAACTCGAGTTGGATTAGCATCCTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-953s21c1
Sequence:CCGGCGGTACTTTGAGATCACAGATCTCGAGATCTGTGATCTCAAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1132s21c1
Sequence:CCGGGCCAAGAAAGTCTGACCTCTTCTCGAGAAGAGGTCAGACTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011778
VALIDATED
CORO1B MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1139s1c1
Sequence:CCGGGCCAAGAAAGTCTGACCTCTTCTCGAGAAGAGGTCAGACTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1225s1c1
Sequence:CCGGGCGGTCAGGATGCTAATCCAACTCGAGTTGGATTAGCATCCTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011778.1-960s1c1
Sequence:CCGGCGGTACTTTGAGATCACAGATCTCGAGATCTGTGATCTCAAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-1198s1c1
Sequence:CCGGCTGCTCTTGAAGCAGAGGATTCTCGAGAATCCTCTGCTTCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011778.1-987s1c1
Sequence:CCGGCCCTACATCCACTTCCTGAATCTCGAGATTCAGGAAGTGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1191s21c1
Sequence:CCGGCTGCTCTTGAAGCAGAGGATTCTCGAGAATCCTCTGCTTCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-980s21c1
Sequence:CCGGCCCTACATCCACTTCCTGAATCTCGAGATTCAGGAAGTGGATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1218s21c1
Sequence:CCGGGCGGTCAGGATGCTAATCCAACTCGAGTTGGATTAGCATCCTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-953s21c1
Sequence:CCGGCGGTACTTTGAGATCACAGATCTCGAGATCTGTGATCTCAAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011778.2-1132s21c1
Sequence:CCGGGCCAAGAAAGTCTGACCTCTTCTCGAGAAGAGGTCAGACTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks