EMAIL THIS PAGE TO A FRIEND

CORO1C

coronin, actin binding protein, 1C

96 Gene Product Result for
Synonyms: HCRNN4
UniProtKB ID: Q9ULV4, B3KU12, Q9NSK5
Gene ID:
Human(23603) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(23790) coronin, actin binding protein 1C
Rat(501841) coronin, actin binding protein 1C
chicken(416893) coronin, actin binding protein, 1C
cow(515798) coronin, actin binding protein, 1C
Horse(100059852) coronin, actin binding protein, 1C
domestic cat(101087687) coronin, actin binding protein, 1C
dog(486318) coronin, actin binding protein, 1C
sheep(101102337) coronin, actin binding protein, 1C
Domestic Rabbit(100354235) coronin, actin binding protein, 1C
naked mole-rat(101714466) coronin, actin binding protein, 1C
domestic guinea pig(100721747) coronin, actin binding protein, 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014325 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014325 Rosetta Predictions human pricing
NM_001109327 Rosetta Predictions rat pricing
NM_011779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150715 predicted 1083
2 SASI_Hs01_00150716 predicted 231
3 SASI_Hs01_00150718 predicted 589
4 SASI_Hs01_00150719 predicted 612
5 SASI_Hs02_00345441 predicted 1445
6 SASI_Hs02_00345442 predicted 304
7 SASI_Hs01_00150721 predicted 1290
8 SASI_Hs01_00150722 predicted 853
9 SASI_Hs01_00150723 predicted 1100
10 SASI_Hs01_00150724 predicted 1318
11 SASI_Hs01_00150717 predicted 1628
12 SASI_Hs01_00150720 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247334 predicted 879
2 SASI_Rn02_00247335 predicted 250
3 SASI_Rn02_00247336 predicted 1322
4 SASI_Rn02_00247337 predicted 642
5 SASI_Rn02_00247338 predicted 572
6 SASI_Rn02_00247339 predicted 1132
7 SASI_Rn02_00247340 predicted 615
8 SASI_Rn02_00247341 predicted 1302
9 SASI_Rn02_00247342 predicted 1485
10 SASI_Rn02_00247343 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025132 predicted 1111
2 SASI_Mm01_00025140 predicted 1608
3 SASI_Mm01_00025141 predicted 1465
4 SASI_Mm01_00025133 predicted 616
5 SASI_Mm02_00321424 predicted 1599
6 SASI_Mm01_00025134 predicted 463
7 SASI_Mm01_00025135 predicted 1426
8 SASI_Mm01_00025136 predicted 1412
9 SASI_Mm01_00025137 predicted 366
10 SASI_Mm01_00025138 predicted 1271
11 SASI_Mm01_00025139 predicted 1441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014325
VALIDATED
CORO1C MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 1C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014325.2-1855s21c1
Sequence:CCGGTGTCGTGCCCAAGTACCCTTTCTCGAGAAAGGGTACTTGGGCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014325.2-953s21c1
Sequence:CCGGGTGACAGCAGTATTCGCTATTCTCGAGAATAGCGAATACTGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014325.2-284s21c1
Sequence:CCGGTGCACAAGACTGGTCGAATTGCTCGAGCAATTCGACCAGTCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014325.2-1463s1c1
Sequence:CCGGGCAATCAAGATGAGCGTATTTCTCGAGAAATACGCTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-589s1c1
Sequence:CCGGGCCCTTATAAACTTGGACGATCTCGAGATCGTCCAAGTTTATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014325.2-364s1c1
Sequence:CCGGCCACATAACGATCAGGTCATTCTCGAGAATGACCTGATCGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-999s1c1
Sequence:CCGGCGTCCACTACCTCAACACATTCTCGAGAATGTGTTGAGGTAGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-1093s1c1
Sequence:CCGGGCCAGATTCTTCAAACTTCATCTCGAGATGAAGTTTGAAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014325
VALIDATED
CORO1C MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 1C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014325.2-1855s21c1
Sequence:CCGGTGTCGTGCCCAAGTACCCTTTCTCGAGAAAGGGTACTTGGGCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014325.2-953s21c1
Sequence:CCGGGTGACAGCAGTATTCGCTATTCTCGAGAATAGCGAATACTGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014325.2-284s21c1
Sequence:CCGGTGCACAAGACTGGTCGAATTGCTCGAGCAATTCGACCAGTCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014325.2-1463s1c1
Sequence:CCGGGCAATCAAGATGAGCGTATTTCTCGAGAAATACGCTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-589s1c1
Sequence:CCGGGCCCTTATAAACTTGGACGATCTCGAGATCGTCCAAGTTTATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014325.2-364s1c1
Sequence:CCGGCCACATAACGATCAGGTCATTCTCGAGAATGACCTGATCGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-999s1c1
Sequence:CCGGCGTCCACTACCTCAACACATTCTCGAGAATGTGTTGAGGTAGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-1093s1c1
Sequence:CCGGGCCAGATTCTTCAAACTTCATCTCGAGATGAAGTTTGAAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014325
VALIDATED
CORO1C MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 1C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014325.2-1855s21c1
Sequence:CCGGTGTCGTGCCCAAGTACCCTTTCTCGAGAAAGGGTACTTGGGCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014325.2-953s21c1
Sequence:CCGGGTGACAGCAGTATTCGCTATTCTCGAGAATAGCGAATACTGCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014325.2-284s21c1
Sequence:CCGGTGCACAAGACTGGTCGAATTGCTCGAGCAATTCGACCAGTCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014325.2-1463s1c1
Sequence:CCGGGCAATCAAGATGAGCGTATTTCTCGAGAAATACGCTCATCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-589s1c1
Sequence:CCGGGCCCTTATAAACTTGGACGATCTCGAGATCGTCCAAGTTTATAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014325.2-364s1c1
Sequence:CCGGCCACATAACGATCAGGTCATTCTCGAGAATGACCTGATCGTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-999s1c1
Sequence:CCGGCGTCCACTACCTCAACACATTCTCGAGAATGTGTTGAGGTAGTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014325.2-1093s1c1
Sequence:CCGGGCCAGATTCTTCAAACTTCATCTCGAGATGAAGTTTGAAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011779
VALIDATED
CORO1C MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 1C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-866s21c1
Sequence:CCGGACCAATTGCTCTCCATGAAATCTCGAGATTTCATGGAGAGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-959s21c1
Sequence:CCGGTGACAGCAGTATCCGCTATTTCTCGAGAAATAGCGGATACTGCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-368s21c1
Sequence:CCGGTCCACATAATGACCAGGTCATCTCGAGATGACCTGGTCATTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011779.3-1756s21c1
Sequence:CCGGCCTACGTTTGAAATGCCAGATCTCGAGATCTGGCATTTCAAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-716s21c1
Sequence:CCGGACAGGAGATTGTGGCGGAGAACTCGAGTTCTCCGCCACAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011779.2-1758s1c1
Sequence:CCGGCCTACGTTTGAAATGCCAGATCTCGAGATCTGGCATTTCAAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-371s1c1
Sequence:CCGGCCACATAATGACCAGGTCATTCTCGAGAATGACCTGGTCATTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011779.2-597s1c1
Sequence:CCGGCCCTCATCAACTTGGACGATACTCGAGTATCGTCCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-875s1c1
Sequence:CCGGGCTCTCCATGAAATGGACACTCTCGAGAGTGTCCATTTCATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-876s1c1
Sequence:CCGGCTCTCCATGAAATGGACACTACTCGAGTAGTGTCCATTTCATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011779
VALIDATED
CORO1C MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 1C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-866s21c1
Sequence:CCGGACCAATTGCTCTCCATGAAATCTCGAGATTTCATGGAGAGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-959s21c1
Sequence:CCGGTGACAGCAGTATCCGCTATTTCTCGAGAAATAGCGGATACTGCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-368s21c1
Sequence:CCGGTCCACATAATGACCAGGTCATCTCGAGATGACCTGGTCATTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011779.3-1756s21c1
Sequence:CCGGCCTACGTTTGAAATGCCAGATCTCGAGATCTGGCATTTCAAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-716s21c1
Sequence:CCGGACAGGAGATTGTGGCGGAGAACTCGAGTTCTCCGCCACAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011779.2-1758s1c1
Sequence:CCGGCCTACGTTTGAAATGCCAGATCTCGAGATCTGGCATTTCAAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-371s1c1
Sequence:CCGGCCACATAATGACCAGGTCATTCTCGAGAATGACCTGGTCATTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011779.2-597s1c1
Sequence:CCGGCCCTCATCAACTTGGACGATACTCGAGTATCGTCCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-875s1c1
Sequence:CCGGGCTCTCCATGAAATGGACACTCTCGAGAGTGTCCATTTCATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-876s1c1
Sequence:CCGGCTCTCCATGAAATGGACACTACTCGAGTAGTGTCCATTTCATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011779
VALIDATED
CORO1C MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 1C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-866s21c1
Sequence:CCGGACCAATTGCTCTCCATGAAATCTCGAGATTTCATGGAGAGCAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-959s21c1
Sequence:CCGGTGACAGCAGTATCCGCTATTTCTCGAGAAATAGCGGATACTGCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-368s21c1
Sequence:CCGGTCCACATAATGACCAGGTCATCTCGAGATGACCTGGTCATTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011779.3-1756s21c1
Sequence:CCGGCCTACGTTTGAAATGCCAGATCTCGAGATCTGGCATTTCAAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011779.3-716s21c1
Sequence:CCGGACAGGAGATTGTGGCGGAGAACTCGAGTTCTCCGCCACAATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011779.2-1758s1c1
Sequence:CCGGCCTACGTTTGAAATGCCAGATCTCGAGATCTGGCATTTCAAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-371s1c1
Sequence:CCGGCCACATAATGACCAGGTCATTCTCGAGAATGACCTGGTCATTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011779.2-597s1c1
Sequence:CCGGCCCTCATCAACTTGGACGATACTCGAGTATCGTCCAAGTTGATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-875s1c1
Sequence:CCGGGCTCTCCATGAAATGGACACTCTCGAGAGTGTCCATTTCATGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011779.2-876s1c1
Sequence:CCGGCTCTCCATGAAATGGACACTACTCGAGTAGTGTCCATTTCATGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks