EMAIL THIS PAGE TO A FRIEND

CORO2A

coronin, actin binding protein, 2A

78 Gene Product Result for
Synonyms: CLIPINB IR10 WDR2
UniProtKB ID: Q92828, Q5TBR5, Q92829, Q9BWS5
Gene ID:
Human(7464) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Mouse(107684) coronin, actin binding protein 2A
Rat(313235) coronin, actin binding protein 2A
Zebrafish(323538) coronin, actin binding protein, 2A
chicken(427373) coronin, actin binding protein, 2A
dog(481625) coronin, actin binding protein, 2A
domestic cat(101092803) coronin, actin binding protein, 2A
Horse(100064061) coronin, actin binding protein, 2A
cow(617620) coronin, actin binding protein, 2A
domestic guinea pig(100717003) coronin, actin binding protein, 2A
naked mole-rat(101720868) coronin, actin binding protein, 2A
sheep(101102958) coronin, actin binding protein, 2A
Domestic Rabbit(100356159) coronin, actin binding protein, 2A
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003389 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157841 MISSION® esiRNA esiRNA human CORO2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003389 Rosetta Predictions human pricing
NM_052820 Rosetta Predictions human pricing
NM_001012101 Rosetta Predictions rat pricing
XM_575819 Rosetta Predictions rat pricing
NM_178893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087190 predicted 868
2 SASI_Hs01_00087192 predicted 788
3 SASI_Hs01_00087193 predicted 1659
4 SASI_Hs01_00087195 predicted 578
5 SASI_Hs01_00087196 predicted 932
6 SASI_Hs02_00335567 predicted 1965
7 SASI_Hs01_00087197 predicted 1774
8 SASI_Hs01_00087199 predicted 1017
9 SASI_Hs02_00335568 predicted 836
10 SASI_Hs02_00335569 predicted 607
11 SASI_Hs01_00087191 predicted 1934
12 SASI_Hs01_00087194 predicted 1699
13 SASI_Hs01_00087198 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229507 predicted 678
2 SASI_Hs01_00229509 predicted 598
3 SASI_Hs01_00229510 predicted 1475
4 SASI_Hs01_00229512 predicted 393
5 SASI_Hs01_00229513 predicted 748
6 SASI_Hs02_00361499 predicted 1782
7 SASI_Hs01_00229514 predicted 1590
8 SASI_Hs01_00229516 predicted 829
9 SASI_Hs02_00361500 predicted 656
10 SASI_Hs02_00361501 predicted 426
11 SASI_Hs01_00229508 predicted 1745
12 SASI_Hs01_00229511 predicted 1523
13 SASI_Hs01_00229515 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067330 predicted 1517
2 SASI_Rn01_00067331 predicted 767
3 SASI_Rn02_00200237 predicted 594
4 SASI_Rn01_00067332 predicted 530
5 SASI_Rn01_00067333 predicted 1451
6 SASI_Rn01_00067334 predicted 580
7 SASI_Rn01_00067335 predicted 885
8 SASI_Rn01_00067336 predicted 1434
9 SASI_Rn01_00067337 predicted 1069
10 SASI_Rn01_00067338 predicted 1168
11 SASI_Rn01_00067339 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167343 predicted 1357
2 SASI_Rn01_00167344 predicted 597
3 SASI_Rn01_00167345 predicted 376
4 SASI_Rn01_00167346 predicted 1291
5 SASI_Rn01_00167347 predicted 416
6 SASI_Rn01_00167348 predicted 722
7 SASI_Rn01_00167349 predicted 1274
8 SASI_Rn01_00167350 predicted 904
9 SASI_Rn01_00167351 predicted 1000
10 SASI_Rn01_00167352 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169953 predicted 680
2 SASI_Mm01_00169954 predicted 464
3 SASI_Mm01_00169955 predicted 1708
4 SASI_Mm01_00169957 predicted 858
5 SASI_Mm01_00169958 predicted 605
6 SASI_Mm01_00169959 predicted 610
7 SASI_Mm01_00169960 predicted 633
8 SASI_Mm01_00169961 predicted 941
9 SASI_Mm01_00169962 predicted 475
10 SASI_Mm02_00349493 predicted 1348
11 SASI_Mm01_00169956 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178893
VALIDATED
CORO2A MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 2A
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-2032s1c1
Sequence:CCGGGCCGAAATTCACTGAGAACAACTCGAGTTGTTCTCAGTGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1833s1c1
Sequence:CCGGGAGCTGTTAATCCAGAGAGAACTCGAGTTCTCTCTGGATTAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1357s1c1
Sequence:CCGGGCTTCTATAAACTGATCACAACTCGAGTTGTGATCAGTTTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-615s1c1
Sequence:CCGGCCTTTCAATGACTTTGAGATTCTCGAGAATCTCAAAGTCATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1226s1c1
Sequence:CCGGCCGCTACTATGAGGTAAGCATCTCGAGATGCTTACCTCATAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.4-642s21c1
Sequence:CCGGTCTGAAGATGCCACGATTAAGCTCGAGCTTAATCGTGGCATCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.3-2029s21c1
Sequence:CCGGGCCGAAATTCACTGAGAACAACTCGAGTTGTTCTCAGTGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178893.3-1830s21c1
Sequence:CCGGGAGCTGTTAATCCAGAGAGAACTCGAGTTCTCTCTGGATTAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.3-612s21c1
Sequence:CCGGCCTTTCAATGACTTTGAGATTCTCGAGAATCTCAAAGTCATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.4-884s21c1
Sequence:CCGGGATCCTCTCCATGTCCTTTAACTCGAGTTAAAGGACATGGAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178893.3-1213s21c1
Sequence:CCGGACGGGAACATCCGCTACTATGCTCGAGCATAGTAGCGGATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178893
VALIDATED
CORO2A MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 2A
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-2032s1c1
Sequence:CCGGGCCGAAATTCACTGAGAACAACTCGAGTTGTTCTCAGTGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1833s1c1
Sequence:CCGGGAGCTGTTAATCCAGAGAGAACTCGAGTTCTCTCTGGATTAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1357s1c1
Sequence:CCGGGCTTCTATAAACTGATCACAACTCGAGTTGTGATCAGTTTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-615s1c1
Sequence:CCGGCCTTTCAATGACTTTGAGATTCTCGAGAATCTCAAAGTCATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1226s1c1
Sequence:CCGGCCGCTACTATGAGGTAAGCATCTCGAGATGCTTACCTCATAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.4-642s21c1
Sequence:CCGGTCTGAAGATGCCACGATTAAGCTCGAGCTTAATCGTGGCATCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.3-2029s21c1
Sequence:CCGGGCCGAAATTCACTGAGAACAACTCGAGTTGTTCTCAGTGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178893.3-1830s21c1
Sequence:CCGGGAGCTGTTAATCCAGAGAGAACTCGAGTTCTCTCTGGATTAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.3-612s21c1
Sequence:CCGGCCTTTCAATGACTTTGAGATTCTCGAGAATCTCAAAGTCATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.4-884s21c1
Sequence:CCGGGATCCTCTCCATGTCCTTTAACTCGAGTTAAAGGACATGGAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178893.3-1213s21c1
Sequence:CCGGACGGGAACATCCGCTACTATGCTCGAGCATAGTAGCGGATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178893
VALIDATED
CORO2A MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 2A
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-2032s1c1
Sequence:CCGGGCCGAAATTCACTGAGAACAACTCGAGTTGTTCTCAGTGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1833s1c1
Sequence:CCGGGAGCTGTTAATCCAGAGAGAACTCGAGTTCTCTCTGGATTAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1357s1c1
Sequence:CCGGGCTTCTATAAACTGATCACAACTCGAGTTGTGATCAGTTTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-615s1c1
Sequence:CCGGCCTTTCAATGACTTTGAGATTCTCGAGAATCTCAAAGTCATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178893.2-1226s1c1
Sequence:CCGGCCGCTACTATGAGGTAAGCATCTCGAGATGCTTACCTCATAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.4-642s21c1
Sequence:CCGGTCTGAAGATGCCACGATTAAGCTCGAGCTTAATCGTGGCATCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.3-2029s21c1
Sequence:CCGGGCCGAAATTCACTGAGAACAACTCGAGTTGTTCTCAGTGAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178893.3-1830s21c1
Sequence:CCGGGAGCTGTTAATCCAGAGAGAACTCGAGTTCTCTCTGGATTAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.3-612s21c1
Sequence:CCGGCCTTTCAATGACTTTGAGATTCTCGAGAATCTCAAAGTCATTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178893.4-884s21c1
Sequence:CCGGGATCCTCTCCATGTCCTTTAACTCGAGTTAAAGGACATGGAGAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178893.3-1213s21c1
Sequence:CCGGACGGGAACATCCGCTACTATGCTCGAGCATAGTAGCGGATGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003389
VALIDATED
CORO2A MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003389.2-2094s1c1
Sequence:CCGGGCCCATGATGAGCTGTAACTTCTCGAGAAGTTACAGCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003389.2-867s1c1
Sequence:CCGGGACCGCAAGATTCGGGTTATTCTCGAGAATAACCCGAATCTTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003389.2-565s1c1
Sequence:CCGGCCTGTTCTGAAGATGCCACAACTCGAGTTGTGGCATCTTCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003389.2-1502s1c1
Sequence:CCGGGAGACCTATCTTCAATTCCATCTCGAGATGGAATTGAAGATAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003389.2-722s1c1
Sequence:CCGGCTATGACTACAAGGTGATGATCTCGAGATCATCACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-722s21c1
Sequence:CCGGCTATGACTACAAGGTGATGATCTCGAGATCATCACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-565s21c1
Sequence:CCGGCCTGTTCTGAAGATGCCACAACTCGAGTTGTGGCATCTTCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-867s21c1
Sequence:CCGGGACCGCAAGATTCGGGTTATTCTCGAGAATAACCCGAATCTTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003389.3-2094s21c1
Sequence:CCGGGCCCATGATGAGCTGTAACTTCTCGAGAAGTTACAGCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-1502s21c1
Sequence:CCGGGAGACCTATCTTCAATTCCATCTCGAGATGGAATTGAAGATAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003389
VALIDATED
CORO2A MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003389.2-2094s1c1
Sequence:CCGGGCCCATGATGAGCTGTAACTTCTCGAGAAGTTACAGCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003389.2-867s1c1
Sequence:CCGGGACCGCAAGATTCGGGTTATTCTCGAGAATAACCCGAATCTTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003389.2-565s1c1
Sequence:CCGGCCTGTTCTGAAGATGCCACAACTCGAGTTGTGGCATCTTCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003389.2-1502s1c1
Sequence:CCGGGAGACCTATCTTCAATTCCATCTCGAGATGGAATTGAAGATAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003389.2-722s1c1
Sequence:CCGGCTATGACTACAAGGTGATGATCTCGAGATCATCACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-722s21c1
Sequence:CCGGCTATGACTACAAGGTGATGATCTCGAGATCATCACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-565s21c1
Sequence:CCGGCCTGTTCTGAAGATGCCACAACTCGAGTTGTGGCATCTTCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-867s21c1
Sequence:CCGGGACCGCAAGATTCGGGTTATTCTCGAGAATAACCCGAATCTTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003389.3-2094s21c1
Sequence:CCGGGCCCATGATGAGCTGTAACTTCTCGAGAAGTTACAGCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-1502s21c1
Sequence:CCGGGAGACCTATCTTCAATTCCATCTCGAGATGGAATTGAAGATAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003389
VALIDATED
CORO2A MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003389.2-2094s1c1
Sequence:CCGGGCCCATGATGAGCTGTAACTTCTCGAGAAGTTACAGCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003389.2-867s1c1
Sequence:CCGGGACCGCAAGATTCGGGTTATTCTCGAGAATAACCCGAATCTTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003389.2-565s1c1
Sequence:CCGGCCTGTTCTGAAGATGCCACAACTCGAGTTGTGGCATCTTCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003389.2-1502s1c1
Sequence:CCGGGAGACCTATCTTCAATTCCATCTCGAGATGGAATTGAAGATAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003389.2-722s1c1
Sequence:CCGGCTATGACTACAAGGTGATGATCTCGAGATCATCACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-722s21c1
Sequence:CCGGCTATGACTACAAGGTGATGATCTCGAGATCATCACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-565s21c1
Sequence:CCGGCCTGTTCTGAAGATGCCACAACTCGAGTTGTGGCATCTTCAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-867s21c1
Sequence:CCGGGACCGCAAGATTCGGGTTATTCTCGAGAATAACCCGAATCTTGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003389.3-2094s21c1
Sequence:CCGGGCCCATGATGAGCTGTAACTTCTCGAGAAGTTACAGCTCATCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003389.3-1502s21c1
Sequence:CCGGGAGACCTATCTTCAATTCCATCTCGAGATGGAATTGAAGATAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks