EMAIL THIS PAGE TO A FRIEND

CORO2B

coronin, actin binding protein, 2B

143 Gene Product Result for
Synonyms: CLIPINC
UniProtKB ID: Q9UQ03, A8K0W3, O94767, Q8TAN1
Gene ID:
Mouse(235431) coronin, actin binding protein, 2B
Rat(300768) coronin, actin binding protein, 2B
sheep(101105413) coronin, actin binding protein, 2B
Domestic Rabbit(100342263) coronin, actin binding protein, 2B
naked mole-rat(101705576) coronin, actin binding protein, 2B
domestic guinea pig(100733574) coronin, actin binding protein, 2B
chicken(415561) coronin, actin binding protein, 2B
domestic cat(101099720) coronin, actin binding protein, 2B
cow(615274) coronin, actin binding protein, 2B
cow(282197) coronin, actin binding protein, 2B
Horse(100052637) coronin, actin binding protein, 2B
dog(487618) coronin, actin binding protein, 2B
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006091 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006091 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006091 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006091 Rosetta Predictions human pricing
XM_001074062 Rosetta Predictions rat pricing
XM_217183 Rosetta Predictions rat pricing
NM_175484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101426 predicted 699
2 SASI_Hs01_00101427 predicted 1223
3 SASI_Hs01_00101428 predicted 1210
4 SASI_Hs01_00101429 predicted 1278
5 SASI_Hs02_00340871 predicted 1361
6 SASI_Hs01_00101430 predicted 1245
7 SASI_Hs02_00340872 predicted 1227
8 SASI_Hs01_00101432 predicted 544
9 SASI_Hs01_00101433 predicted 630
10 SASI_Hs01_00101434 predicted 901
11 SASI_Hs01_00101425 predicted 288
12 SASI_Hs01_00101431 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344927 predicted 1964
2 SASI_Rn02_00344928 predicted 1345
3 SASI_Rn02_00344929 predicted 1266
4 SASI_Rn02_00344930 predicted 832
5 SASI_Rn02_00344931 predicted 1506
6 SASI_Rn02_00344932 predicted 752
7 SASI_Rn02_00344933 predicted 1994
8 SASI_Rn02_00344934 predicted 981
9 SASI_Rn02_00344935 predicted 1358
10 SASI_Rn02_00344936 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377040 predicted 1962
2 SASI_Rn02_00377041 predicted 1348
3 SASI_Rn02_00377042 predicted 1264
4 SASI_Rn02_00377043 predicted 833
5 SASI_Rn02_00377044 predicted 1505
6 SASI_Rn02_00377045 predicted 749
7 SASI_Rn02_00377046 predicted 1986
8 SASI_Rn02_00377047 predicted 980
9 SASI_Rn02_00377048 predicted 1358
10 SASI_Rn02_00377049 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346400 predicted 1324
2 SASI_Mm01_00186787 predicted 1572
3 SASI_Mm01_00186788 predicted 1572
4 SASI_Mm01_00186789 predicted 1982
5 SASI_Mm01_00186790 predicted 1012
6 SASI_Mm01_00186791 predicted 1412
7 SASI_Mm01_00186792 predicted 1207
8 SASI_Mm01_00186795 predicted 976
9 SASI_Mm01_00186796 predicted 1113
10 SASI_Mm02_00346401 predicted 1057
11 SASI_Mm01_00186793 predicted 1054
12 SASI_Mm01_00186794 predicted 1259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175484
VALIDATED
CORO2B MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 2B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175484.3-3093s21c1
Sequence:CCGGCCTACTTTACAGTGAAGGTAACTCGAGTTACCTTCACTGTAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-1012s21c1
Sequence:CCGGGCCGTGTTCTACAGGAGGCAACTCGAGTTGCCTCCTGTAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-1632s21c1
Sequence:CCGGGTTGTCGTCAACGGCATAGATCTCGAGATCTATGCCGTTGACGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-848s21c1
Sequence:CCGGCTATGACTACAAGGTCCTCATCTCGAGATGAGGACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175484.1-3091s1c1
Sequence:CCGGCCTACTTTACAGTGAAGGTAACTCGAGTTACCTTCACTGTAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-849s1c1
Sequence:CCGGCTATGACTACAAGGTCCTCATCTCGAGATGAGGACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175484.1-481s1c1
Sequence:CCGGCCCATCACCAAGAATGTACATCTCGAGATGTACATTCTTGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-1013s1c1
Sequence:CCGGGCCGTGTTCTACAGGAGGCAACTCGAGTTGCCTCCTGTAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-1633s1c1
Sequence:CCGGGTTGTCGTCAACGGCATAGATCTCGAGATCTATGCCGTTGACGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175484
VALIDATED
CORO2B MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 2B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175484.3-3093s21c1
Sequence:CCGGCCTACTTTACAGTGAAGGTAACTCGAGTTACCTTCACTGTAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-1012s21c1
Sequence:CCGGGCCGTGTTCTACAGGAGGCAACTCGAGTTGCCTCCTGTAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-1632s21c1
Sequence:CCGGGTTGTCGTCAACGGCATAGATCTCGAGATCTATGCCGTTGACGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-848s21c1
Sequence:CCGGCTATGACTACAAGGTCCTCATCTCGAGATGAGGACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175484.1-3091s1c1
Sequence:CCGGCCTACTTTACAGTGAAGGTAACTCGAGTTACCTTCACTGTAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-849s1c1
Sequence:CCGGCTATGACTACAAGGTCCTCATCTCGAGATGAGGACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175484.1-481s1c1
Sequence:CCGGCCCATCACCAAGAATGTACATCTCGAGATGTACATTCTTGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-1013s1c1
Sequence:CCGGGCCGTGTTCTACAGGAGGCAACTCGAGTTGCCTCCTGTAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-1633s1c1
Sequence:CCGGGTTGTCGTCAACGGCATAGATCTCGAGATCTATGCCGTTGACGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175484
VALIDATED
CORO2B MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 2B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316127    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175484.3-3093s21c1
Sequence:CCGGCCTACTTTACAGTGAAGGTAACTCGAGTTACCTTCACTGTAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-1012s21c1
Sequence:CCGGGCCGTGTTCTACAGGAGGCAACTCGAGTTGCCTCCTGTAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-1632s21c1
Sequence:CCGGGTTGTCGTCAACGGCATAGATCTCGAGATCTATGCCGTTGACGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175484.3-848s21c1
Sequence:CCGGCTATGACTACAAGGTCCTCATCTCGAGATGAGGACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175484.1-3091s1c1
Sequence:CCGGCCTACTTTACAGTGAAGGTAACTCGAGTTACCTTCACTGTAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-849s1c1
Sequence:CCGGCTATGACTACAAGGTCCTCATCTCGAGATGAGGACCTTGTAGTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175484.1-481s1c1
Sequence:CCGGCCCATCACCAAGAATGTACATCTCGAGATGTACATTCTTGGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-1013s1c1
Sequence:CCGGGCCGTGTTCTACAGGAGGCAACTCGAGTTGCCTCCTGTAGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175484.1-1633s1c1
Sequence:CCGGGTTGTCGTCAACGGCATAGATCTCGAGATCTATGCCGTTGACGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006091
CORO2B MISSION shRNA Bacterial Glycerol Stock
coronin, actin binding protein, 2B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006091.1-2667s1c1
Sequence:CCGGCGCATCCGTATAGCACTTTAACTCGAGTTAAAGTGCTATACGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1192s1c1
Sequence:CCGGGATGTCTTTGAAAGAAGGCTACTCGAGTAGCCTTCTTTCAAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-901s1c1
Sequence:CCGGCTACGAGATCAGCACTGAGAACTCGAGTTCTCAGTGCTGATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1265s1c1
Sequence:CCGGGTTGTGGTCAACGGAATAGATCTCGAGATCTATTCCGTTGACCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1102s1c1
Sequence:CCGGCCAGGAAGACATTTACCCAATCTCGAGATTGGGTAAATGTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006091
CORO2B MISSION shRNA shRNA Plasmid DNA
coronin, actin binding protein, 2B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006091.1-2667s1c1
Sequence:CCGGCGCATCCGTATAGCACTTTAACTCGAGTTAAAGTGCTATACGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1192s1c1
Sequence:CCGGGATGTCTTTGAAAGAAGGCTACTCGAGTAGCCTTCTTTCAAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-901s1c1
Sequence:CCGGCTACGAGATCAGCACTGAGAACTCGAGTTCTCAGTGCTGATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1265s1c1
Sequence:CCGGGTTGTGGTCAACGGAATAGATCTCGAGATCTATTCCGTTGACCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1102s1c1
Sequence:CCGGCCAGGAAGACATTTACCCAATCTCGAGATTGGGTAAATGTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006091
CORO2B MISSION shRNA Lentiviral Transduction Particles
coronin, actin binding protein, 2B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006091.1-2667s1c1
Sequence:CCGGCGCATCCGTATAGCACTTTAACTCGAGTTAAAGTGCTATACGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1192s1c1
Sequence:CCGGGATGTCTTTGAAAGAAGGCTACTCGAGTAGCCTTCTTTCAAAGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-901s1c1
Sequence:CCGGCTACGAGATCAGCACTGAGAACTCGAGTTCTCAGTGCTGATCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1265s1c1
Sequence:CCGGGTTGTGGTCAACGGAATAGATCTCGAGATCTATTCCGTTGACCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006091.1-1102s1c1
Sequence:CCGGCCAGGAAGACATTTACCCAATCTCGAGATTGGGTAAATGTCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks