EMAIL THIS PAGE TO A FRIEND

CORO7

coronin 7

96 Gene Product Result for
Synonyms: 0610011B16Rik CRN7 POD1
UniProtKB ID: P57737, B4DFD6, B4DL18, I3L416, Q17RK4
Gene ID:
Human(79585) Summary: Coronins, such as CORO7, constitute an evolutionarily conserved family of WD-repeat actin-binding proteins. CORO7 plays a role in Golgi complex morphology and function (Rybakin et al., 2004, 2006 [PubMed 15327992]
Mouse(78885) coronin 7
Rat(192276) coronin 7
sheep(101102529) coronin 7
Zebrafish(569563) coronin 7
dog(490027) coronin 7
chicken(416670) coronin 7
cow(527934) coronin 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024535 Rosetta Predictions human pricing
XM_001077234 Rosetta Predictions rat pricing
XM_220167 Rosetta Predictions rat pricing
NM_030205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112084 predicted 1092
2 SASI_Hs01_00112085 predicted 2179
3 SASI_Hs01_00112086 predicted 361
4 SASI_Hs02_00356827 predicted 2693
5 SASI_Hs01_00112087 predicted 812
6 SASI_Hs01_00112088 predicted 3272
7 SASI_Hs01_00112089 predicted 1120
8 SASI_Hs01_00112091 predicted 527
9 SASI_Hs01_00112092 predicted 2942
10 SASI_Hs01_00112093 predicted 1549
11 SASI_Hs01_00112090 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356283 predicted 2445
2 SASI_Rn02_00356284 predicted 2651
3 SASI_Rn02_00356285 predicted 1950
4 SASI_Rn02_00356286 predicted 2969
5 SASI_Rn02_00356287 predicted 1572
6 SASI_Rn02_00356288 predicted 969
7 SASI_Rn02_00356289 predicted 617
8 SASI_Rn02_00356290 predicted 2366
9 SASI_Rn02_00356291 predicted 1602
10 SASI_Rn02_00356292 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220167 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379075 predicted 2460
2 SASI_Rn02_00379076 predicted 2658
3 SASI_Rn02_00379077 predicted 1963
4 SASI_Rn02_00379078 predicted 2976
5 SASI_Rn02_00379079 predicted 1576
6 SASI_Rn02_00379080 predicted 982
7 SASI_Rn02_00379081 predicted 633
8 SASI_Rn02_00379082 predicted 2379
9 SASI_Rn02_00379083 predicted 1604
10 SASI_Rn02_00379084 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114461 predicted 2624
2 SASI_Mm02_00336626 predicted 1548
3 SASI_Mm01_00114462 predicted 920
4 SASI_Mm01_00114463 predicted 259
5 SASI_Mm01_00114464 predicted 650
6 SASI_Mm01_00114465 predicted 2947
7 SASI_Mm01_00114466 predicted 230
8 SASI_Mm01_00114467 predicted 770
9 SASI_Mm01_00114468 predicted 410
10 SASI_Mm01_00114469 predicted 1699
11 SASI_Mm01_00114470 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024535
CORO7 MISSION shRNA Bacterial Glycerol Stock
coronin 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-365s21c1
Sequence:CCGGACTTGGACTTCTCGCCCTTTGCTCGAGCAAAGGGCGAGAAGTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-1964s21c1
Sequence:CCGGATGACCTCACTGTTCGCATCTCTCGAGAGATGCGAACAGTGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024535.3-3239s1c1
Sequence:CCGGTGGCCTCATCCAGGATCTTTGCTCGAGCAAAGATCCTGGATGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.3-686s1c1
Sequence:CCGGACAAGCAGCTGCGGATCTTTGCTCGAGCAAAGATCCGCAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-2024s21c1
Sequence:CCGGGCCACCAAGACCAGATCTTCACTCGAGTGAAGATCTGGTCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-2507s1c1
Sequence:CCGGCGGAAAGAGTTCTTCCAGGATCTCGAGATCCTGGAAGAACTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-2108s1c1
Sequence:CCGGCGCATTGTCTGGGTATGTGATCTCGAGATCACATACCCAGACAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-110s1c1
Sequence:CCGGGAGTCCTGGATCAGTGACATTCTCGAGAATGTCACTGATCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024535
CORO7 MISSION shRNA shRNA Plasmid DNA
coronin 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-365s21c1
Sequence:CCGGACTTGGACTTCTCGCCCTTTGCTCGAGCAAAGGGCGAGAAGTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-1964s21c1
Sequence:CCGGATGACCTCACTGTTCGCATCTCTCGAGAGATGCGAACAGTGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024535.3-3239s1c1
Sequence:CCGGTGGCCTCATCCAGGATCTTTGCTCGAGCAAAGATCCTGGATGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.3-686s1c1
Sequence:CCGGACAAGCAGCTGCGGATCTTTGCTCGAGCAAAGATCCGCAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-2024s21c1
Sequence:CCGGGCCACCAAGACCAGATCTTCACTCGAGTGAAGATCTGGTCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-2507s1c1
Sequence:CCGGCGGAAAGAGTTCTTCCAGGATCTCGAGATCCTGGAAGAACTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-2108s1c1
Sequence:CCGGCGCATTGTCTGGGTATGTGATCTCGAGATCACATACCCAGACAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-110s1c1
Sequence:CCGGGAGTCCTGGATCAGTGACATTCTCGAGAATGTCACTGATCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024535
CORO7 MISSION shRNA Lentiviral Transduction Particles
coronin 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-365s21c1
Sequence:CCGGACTTGGACTTCTCGCCCTTTGCTCGAGCAAAGGGCGAGAAGTCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-1964s21c1
Sequence:CCGGATGACCTCACTGTTCGCATCTCTCGAGAGATGCGAACAGTGAGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220028    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024535.3-3239s1c1
Sequence:CCGGTGGCCTCATCCAGGATCTTTGCTCGAGCAAAGATCCTGGATGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220027    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.3-686s1c1
Sequence:CCGGACAAGCAGCTGCGGATCTTTGCTCGAGCAAAGATCCGCAGCTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024535.3-2024s21c1
Sequence:CCGGGCCACCAAGACCAGATCTTCACTCGAGTGAAGATCTGGTCTTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156149    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-2507s1c1
Sequence:CCGGCGGAAAGAGTTCTTCCAGGATCTCGAGATCCTGGAAGAACTCTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-2108s1c1
Sequence:CCGGCGCATTGTCTGGGTATGTGATCTCGAGATCACATACCCAGACAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024535.1-110s1c1
Sequence:CCGGGAGTCCTGGATCAGTGACATTCTCGAGAATGTCACTGATCCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030205
CORO7 MISSION shRNA Bacterial Glycerol Stock
coronin 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030205.2-3427s1c1
Sequence:CCGGCCCATAACAAACAGCCTATATCTCGAGATATAGGCTGTTTGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-1937s1c1
Sequence:CCGGGCTTCCAGTTCCTATGATCTACTCGAGTAGATCATAGGAACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-183s1c1
Sequence:CCGGTCAGTGATATTCGTGCTGTAACTCGAGTTACAGCACGAATATCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-2633s1c1
Sequence:CCGGGCCTGGTTTGAGGGTGCTAATCTCGAGATTAGCACCCTCAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-671s1c1
Sequence:CCGGGCATGTAAGGACAAGCAGCTTCTCGAGAAGCTGCTTGTCCTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030205
CORO7 MISSION shRNA shRNA Plasmid DNA
coronin 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030205.2-3427s1c1
Sequence:CCGGCCCATAACAAACAGCCTATATCTCGAGATATAGGCTGTTTGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-1937s1c1
Sequence:CCGGGCTTCCAGTTCCTATGATCTACTCGAGTAGATCATAGGAACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-183s1c1
Sequence:CCGGTCAGTGATATTCGTGCTGTAACTCGAGTTACAGCACGAATATCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-2633s1c1
Sequence:CCGGGCCTGGTTTGAGGGTGCTAATCTCGAGATTAGCACCCTCAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-671s1c1
Sequence:CCGGGCATGTAAGGACAAGCAGCTTCTCGAGAAGCTGCTTGTCCTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030205
CORO7 MISSION shRNA Lentiviral Transduction Particles
coronin 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030205.2-3427s1c1
Sequence:CCGGCCCATAACAAACAGCCTATATCTCGAGATATAGGCTGTTTGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-1937s1c1
Sequence:CCGGGCTTCCAGTTCCTATGATCTACTCGAGTAGATCATAGGAACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-183s1c1
Sequence:CCGGTCAGTGATATTCGTGCTGTAACTCGAGTTACAGCACGAATATCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-2633s1c1
Sequence:CCGGGCCTGGTTTGAGGGTGCTAATCTCGAGATTAGCACCCTCAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030205.2-671s1c1
Sequence:CCGGGCATGTAAGGACAAGCAGCTTCTCGAGAAGCTGCTTGTCCTTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks