EMAIL THIS PAGE TO A FRIEND

CORT

cortistatin

50 Gene Product Result for
Synonyms: CST-14 CST-17 CST-29
UniProtKB ID: O00230, Q5T6G0, Q6UX11
Gene ID:
Human(1325) Summary: This gene encodes a neuropeptide that is structurally similar to somatostatin. It binds to all known somatostatin receptors, and shares many pharmacological and functional properties with somatostatin, including the depression of neuronal activity. However, it also has many properties distinct from somatostatin, such as induction of slow-wave sleep, apparently by antagonism of the excitatory effects of acetylcholine on the cortex, reduction of locomotor activity, and activation of cation selective currents not responsive to somatostatin. The preproprotein undergoes further processing into multiple mature products. Read-through transcripts exist between this gene and the upstream APITD1 (apoptosis-inducing, TAF9-like domain 1) gene, as represented in GeneID:100526739. [provided by RefSeq, Nov 2010]
Mouse(12854) cortistatin
Rat(25305) cortistatin
chicken(100310731) Corticosterone response
chicken(100310456) Corticosterone response
Horse(100057083) cortistatin
cow(101409356) Blood cortisol level
cow(781658) cortistatin
cow(101409442) Blood cortisol level
chicken(100309627) Corticosterone response
chicken(100327397) Corticosterone response
chicken(100327596) Corticosterone response
sheep(100233238) cortistatin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107409 Anti-CORT antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001302 Rosetta Predictions human pricing
NM_012835 Rosetta Predictions rat pricing
NM_007745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093168 predicted 196
2 SASI_Hs01_00093169 predicted 631
3 SASI_Hs01_00093172 predicted 628
4 SASI_Hs02_00331575 predicted 603
5 SASI_Hs01_00093173 predicted 413
6 SASI_Hs01_00093174 predicted 631
7 SASI_Hs01_00093175 predicted 655
8 SASI_Hs02_00331576 predicted 411
9 SASI_Hs01_00093176 predicted 631
10 SASI_Hs01_00093177 predicted 441
11 SASI_Hs01_00093170 predicted 200
12 SASI_Hs01_00093171 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046618 predicted 168
2 SASI_Rn01_00046619 predicted 375
3 SASI_Rn01_00046620 predicted 177
4 SASI_Rn01_00046621 predicted 389
5 SASI_Rn01_00046622 predicted 386
6 SASI_Rn01_00046623 predicted 371
7 SASI_Rn01_00046624 predicted 402
8 SASI_Rn01_00046625 predicted 179
9 SASI_Rn01_00046626 predicted 402
10 SASI_Rn01_00046627 predicted 174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312347 predicted 228
2 SASI_Mm01_00151941 predicted 237
3 SASI_Mm01_00151942 predicted 260
4 SASI_Mm01_00151943 predicted 235
5 SASI_Mm01_00151944 predicted 201
6 SASI_Mm01_00151946 predicted 447
7 SASI_Mm01_00151947 predicted 188
8 SASI_Mm01_00151948 predicted 444
9 SASI_Mm01_00151949 predicted 441
10 SASI_Mm01_00151950 predicted 120
11 SASI_Mm01_00151945 predicted 470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001302
CORT MISSION shRNA Bacterial Glycerol Stock
cortistatin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-444s1c1
Sequence:CCGGGCCTCCTGACTTTCCTCGCTTCTCGAGAAGCGAGGAAAGTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-292s1c1
Sequence:CCGGGCTCCAGTCAGCCCACAAGATCTCGAGATCTTGTGGGCTGACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-606s1c1
Sequence:CCGGAGACCTTCTCCTCCTGCAAATCTCGAGATTTGCAGGAGGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-202s1c1
Sequence:CCGGCCCACCAAGCTCCAAAGAAGACTCGAGTCTTCTTTGGAGCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-394s1c1
Sequence:CCGGCGGCCGAGACAGCGAGCATATCTCGAGATATGCTCGCTGTCTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-300s21c1
Sequence:CCGGCAGCCCACAAGATGCCATTGTCTCGAGACAATGGCATCTTGTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-212s21c1
Sequence:CCGGTCCAAAGAAGAGACCCAAGTCCTCGAGGACTTGGGTCTCTTCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-240s21c1
Sequence:CCGGCATTGATTTCAGGGCTGCCAGCTCGAGCTGGCAGCCCTGAAATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-282s21c1
Sequence:CCGGTGGGAGAGAAGCTCCAGTCAGCTCGAGCTGACTGGAGCTTCTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001302
CORT MISSION shRNA shRNA Plasmid DNA
cortistatin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-444s1c1
Sequence:CCGGGCCTCCTGACTTTCCTCGCTTCTCGAGAAGCGAGGAAAGTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-292s1c1
Sequence:CCGGGCTCCAGTCAGCCCACAAGATCTCGAGATCTTGTGGGCTGACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-606s1c1
Sequence:CCGGAGACCTTCTCCTCCTGCAAATCTCGAGATTTGCAGGAGGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-202s1c1
Sequence:CCGGCCCACCAAGCTCCAAAGAAGACTCGAGTCTTCTTTGGAGCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-394s1c1
Sequence:CCGGCGGCCGAGACAGCGAGCATATCTCGAGATATGCTCGCTGTCTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-300s21c1
Sequence:CCGGCAGCCCACAAGATGCCATTGTCTCGAGACAATGGCATCTTGTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-212s21c1
Sequence:CCGGTCCAAAGAAGAGACCCAAGTCCTCGAGGACTTGGGTCTCTTCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-240s21c1
Sequence:CCGGCATTGATTTCAGGGCTGCCAGCTCGAGCTGGCAGCCCTGAAATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-282s21c1
Sequence:CCGGTGGGAGAGAAGCTCCAGTCAGCTCGAGCTGACTGGAGCTTCTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001302
CORT MISSION shRNA Lentiviral Transduction Particles
cortistatin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-444s1c1
Sequence:CCGGGCCTCCTGACTTTCCTCGCTTCTCGAGAAGCGAGGAAAGTCAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-292s1c1
Sequence:CCGGGCTCCAGTCAGCCCACAAGATCTCGAGATCTTGTGGGCTGACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-606s1c1
Sequence:CCGGAGACCTTCTCCTCCTGCAAATCTCGAGATTTGCAGGAGGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-202s1c1
Sequence:CCGGCCCACCAAGCTCCAAAGAAGACTCGAGTCTTCTTTGGAGCTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001302.2-394s1c1
Sequence:CCGGCGGCCGAGACAGCGAGCATATCTCGAGATATGCTCGCTGTCTCGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-300s21c1
Sequence:CCGGCAGCCCACAAGATGCCATTGTCTCGAGACAATGGCATCTTGTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-212s21c1
Sequence:CCGGTCCAAAGAAGAGACCCAAGTCCTCGAGGACTTGGGTCTCTTCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-240s21c1
Sequence:CCGGCATTGATTTCAGGGCTGCCAGCTCGAGCTGGCAGCCCTGAAATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001302.3-282s21c1
Sequence:CCGGTGGGAGAGAAGCTCCAGTCAGCTCGAGCTGACTGGAGCTTCTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007745
CORT MISSION shRNA Bacterial Glycerol Stock
cortistatin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-197s21c1
Sequence:CCGGTACTGGCCAGGACAGTGTGCACTCGAGTGCACACTGTCCTGGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-122s21c1
Sequence:CCGGCAAGTGGCCCTCAGCCTTCGGCTCGAGCCGAAGGCTGAGGGCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-249s21c1
Sequence:CCGGACTTTCCTTGCCTGGTGGCACCTCGAGGTGCCACCAGGCAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-323s21c1
Sequence:CCGGGCTGTCCAAGAGCCAGGAAAGCTCGAGCTTTCCTGGCTCTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-237s21c1
Sequence:CCGGAGCGGCCTTCTGACTTTCCTTCTCGAGAAGGAAAGTCAGAAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007745
CORT MISSION shRNA shRNA Plasmid DNA
cortistatin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-197s21c1
Sequence:CCGGTACTGGCCAGGACAGTGTGCACTCGAGTGCACACTGTCCTGGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-122s21c1
Sequence:CCGGCAAGTGGCCCTCAGCCTTCGGCTCGAGCCGAAGGCTGAGGGCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-249s21c1
Sequence:CCGGACTTTCCTTGCCTGGTGGCACCTCGAGGTGCCACCAGGCAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-323s21c1
Sequence:CCGGGCTGTCCAAGAGCCAGGAAAGCTCGAGCTTTCCTGGCTCTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-237s21c1
Sequence:CCGGAGCGGCCTTCTGACTTTCCTTCTCGAGAAGGAAAGTCAGAAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007745
CORT MISSION shRNA Lentiviral Transduction Particles
cortistatin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-197s21c1
Sequence:CCGGTACTGGCCAGGACAGTGTGCACTCGAGTGCACACTGTCCTGGCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-122s21c1
Sequence:CCGGCAAGTGGCCCTCAGCCTTCGGCTCGAGCCGAAGGCTGAGGGCCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-249s21c1
Sequence:CCGGACTTTCCTTGCCTGGTGGCACCTCGAGGTGCCACCAGGCAAGGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-323s21c1
Sequence:CCGGGCTGTCCAAGAGCCAGGAAAGCTCGAGCTTTCCTGGCTCTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007745.3-237s21c1
Sequence:CCGGAGCGGCCTTCTGACTTTCCTTCTCGAGAAGGAAAGTCAGAAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks