EMAIL THIS PAGE TO A FRIEND

COTL1

coactosin-like 1 (Dictyostelium)

62 Gene Product Result for
Synonyms: CLP
UniProtKB ID: Q14019, B2RDU3, D3DUL9, Q86XM5
Gene ID:
Human(23406) Summary: This gene encodes one of the numerous actin-binding proteins which regulate the actin cytoskeleton. This protein binds F-actin, and also interacts with 5-lipoxygenase, which is the first committed enzyme in leukotriene biosynthesis. Although this gene has been reported to map to chromosome 17 in the Smith-Magenis syndrome region, the best alignments for this gene are to chromosome 16. The Smith-Magenis syndrome region is the site of two related pseudogenes. [provided by RefSeq, Jul 2008]
Mouse(72042) coactosin-like 1 (Dictyostelium)
Rat(361422) coactosin-like 1 (Dictyostelium)
sheep(101103415) coactosin-like 1 (Dictyostelium)
domestic guinea pig(100715923) coactosin-like 1 (Dictyostelium)
naked mole-rat(101726236) coactosin-like 1 (Dictyostelium)
Zebrafish(336381) coactosin-like 1 (Dictyostelium)
cow(617165) coactosin-like 1 (Dictyostelium)
chicken(768420) coactosin-like 1 (Dictyostelium)
dog(489680) coactosin-like 1 (Dictyostelium)
domestic cat(101089161) coactosin-like 1 (Dictyostelium)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021149 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021149 Rosetta Predictions human pricing
NM_001108452 Rosetta Predictions rat pricing
NM_028071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130121 predicted 434
2 SASI_Hs01_00130122 predicted 457
3 SASI_Hs01_00130123 predicted 458
4 SASI_Hs02_00354685 predicted 287
5 SASI_Hs01_00130124 predicted 1073
6 SASI_Hs02_00354686 predicted 1007
7 SASI_Hs01_00130128 predicted 944
8 SASI_Hs01_00130129 predicted 147
9 SASI_Hs01_00130130 predicted 269
10 SASI_Hs02_00354687 predicted 841
11 SASI_Hs01_00130125 predicted 186
12 SASI_Hs01_00130126 predicted 310
13 SASI_Hs01_00130127 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108452 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238779 predicted 1031
2 SASI_Rn02_00238780 predicted 284
3 SASI_Rn02_00238781 predicted 322
4 SASI_Rn02_00238782 predicted 460
5 SASI_Rn02_00238783 predicted 564
6 SASI_Rn02_00238784 predicted 226
7 SASI_Rn02_00238785 predicted 328
8 SASI_Rn02_00238786 predicted 767
9 SASI_Rn02_00238787 predicted 957
10 SASI_Rn02_00238788 predicted 169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050203 predicted 834
2 SASI_Mm01_00050204 predicted 457
3 SASI_Mm01_00050205 predicted 1024
4 SASI_Mm02_00333286 predicted 351
5 SASI_Mm02_00333287 predicted 317
6 SASI_Mm01_00050206 predicted 333
7 SASI_Mm01_00050207 predicted 765
8 SASI_Mm01_00050208 predicted 395
9 SASI_Mm01_00050209 predicted 349
10 SASI_Mm01_00050210 predicted 303
11 SASI_Mm01_00050211 predicted 543
12 SASI_Mm01_00050212 predicted 261
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028071
VALIDATED
COTL1 MISSION shRNA Bacterial Glycerol Stock
coactosin-like 1 (Dictyostelium)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-397s21c1
Sequence:CCGGGATCCAAGTTTGCCCTCATCACTCGAGTGATGAGGGCAAACTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-764s21c1
Sequence:CCGGCAAGCTCACCAAGCATCATTCCTCGAGGAATGATGCTTGGTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-482s21c1
Sequence:CCGGGAAGGAGGTGGTCCAGAATTTCTCGAGAAATTCTGGACCACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-587s21c1
Sequence:CCGGCTACGACGCTCAGTCAGAGTACTCGAGTACTCTGACTGAGCGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-304s21c1
Sequence:CCGGGAGCAGATTACCAGCACTTCACTCGAGTGAAGTGCTGGTAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-366s1c1
Sequence:CCGGGTTTGCCCTCATCACATGGATCTCGAGATCCATGTGATGAGGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-362s1c1
Sequence:CCGGCCAAGTTTGCCCTCATCACATCTCGAGATGTGATGAGGGCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-266s1c1
Sequence:CCGGGAGCAGATTACCAGCACTTCACTCGAGTGAAGTGCTGGTAATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-359s1c1
Sequence:CCGGGATCCAAGTTTGCCCTCATCACTCGAGTGATGAGGGCAAACTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028071
VALIDATED
COTL1 MISSION shRNA shRNA Plasmid DNA
coactosin-like 1 (Dictyostelium)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-397s21c1
Sequence:CCGGGATCCAAGTTTGCCCTCATCACTCGAGTGATGAGGGCAAACTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-764s21c1
Sequence:CCGGCAAGCTCACCAAGCATCATTCCTCGAGGAATGATGCTTGGTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-482s21c1
Sequence:CCGGGAAGGAGGTGGTCCAGAATTTCTCGAGAAATTCTGGACCACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-587s21c1
Sequence:CCGGCTACGACGCTCAGTCAGAGTACTCGAGTACTCTGACTGAGCGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-304s21c1
Sequence:CCGGGAGCAGATTACCAGCACTTCACTCGAGTGAAGTGCTGGTAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-366s1c1
Sequence:CCGGGTTTGCCCTCATCACATGGATCTCGAGATCCATGTGATGAGGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-362s1c1
Sequence:CCGGCCAAGTTTGCCCTCATCACATCTCGAGATGTGATGAGGGCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-266s1c1
Sequence:CCGGGAGCAGATTACCAGCACTTCACTCGAGTGAAGTGCTGGTAATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-359s1c1
Sequence:CCGGGATCCAAGTTTGCCCTCATCACTCGAGTGATGAGGGCAAACTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028071
VALIDATED
COTL1 MISSION shRNA Lentiviral Transduction Particles
coactosin-like 1 (Dictyostelium)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-397s21c1
Sequence:CCGGGATCCAAGTTTGCCCTCATCACTCGAGTGATGAGGGCAAACTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-764s21c1
Sequence:CCGGCAAGCTCACCAAGCATCATTCCTCGAGGAATGATGCTTGGTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-482s21c1
Sequence:CCGGGAAGGAGGTGGTCCAGAATTTCTCGAGAAATTCTGGACCACCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-587s21c1
Sequence:CCGGCTACGACGCTCAGTCAGAGTACTCGAGTACTCTGACTGAGCGTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028071.3-304s21c1
Sequence:CCGGGAGCAGATTACCAGCACTTCACTCGAGTGAAGTGCTGGTAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-366s1c1
Sequence:CCGGGTTTGCCCTCATCACATGGATCTCGAGATCCATGTGATGAGGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-362s1c1
Sequence:CCGGCCAAGTTTGCCCTCATCACATCTCGAGATGTGATGAGGGCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-266s1c1
Sequence:CCGGGAGCAGATTACCAGCACTTCACTCGAGTGAAGTGCTGGTAATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028071.1-359s1c1
Sequence:CCGGGATCCAAGTTTGCCCTCATCACTCGAGTGATGAGGGCAAACTTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021149
VALIDATED
COTL1 MISSION shRNA Bacterial Glycerol Stock
coactosin-like 1 (Dictyostelium)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-482s21c1
Sequence:CCGGGTTTGTGATCAGTGATCGGAACTCGAGTTCCGATCACTGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-461s21c1
Sequence:CCGGCGTACAGAATTTCGCTAAGGACTCGAGTCCTTAGCGAAATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-515s21c1
Sequence:CCGGAGATTTCATCAAGAGCGAGCTCTCGAGAGCTCGCTCTTGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-356s21c1
Sequence:CCGGCATGAGCAAGAGGTCCAAGTTCTCGAGAACTTGGACCTCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-784s21c1
Sequence:CCGGCCTCTTTCTTTGATCTTCTTTCTCGAGAAAGAAGATCAAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-784s1c1
Sequence:CCGGCCTCTTTCTTTGATCTTCTTTCTCGAGAAAGAAGATCAAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-356s1c1
Sequence:CCGGCATGAGCAAGAGGTCCAAGTTCTCGAGAACTTGGACCTCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-515s1c1
Sequence:CCGGAGATTTCATCAAGAGCGAGCTCTCGAGAGCTCGCTCTTGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-461s1c1
Sequence:CCGGCGTACAGAATTTCGCTAAGGACTCGAGTCCTTAGCGAAATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-482s1c1
Sequence:CCGGGTTTGTGATCAGTGATCGGAACTCGAGTTCCGATCACTGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021149
VALIDATED
COTL1 MISSION shRNA shRNA Plasmid DNA
coactosin-like 1 (Dictyostelium)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-482s21c1
Sequence:CCGGGTTTGTGATCAGTGATCGGAACTCGAGTTCCGATCACTGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-461s21c1
Sequence:CCGGCGTACAGAATTTCGCTAAGGACTCGAGTCCTTAGCGAAATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-515s21c1
Sequence:CCGGAGATTTCATCAAGAGCGAGCTCTCGAGAGCTCGCTCTTGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-356s21c1
Sequence:CCGGCATGAGCAAGAGGTCCAAGTTCTCGAGAACTTGGACCTCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-784s21c1
Sequence:CCGGCCTCTTTCTTTGATCTTCTTTCTCGAGAAAGAAGATCAAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-784s1c1
Sequence:CCGGCCTCTTTCTTTGATCTTCTTTCTCGAGAAAGAAGATCAAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-356s1c1
Sequence:CCGGCATGAGCAAGAGGTCCAAGTTCTCGAGAACTTGGACCTCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-515s1c1
Sequence:CCGGAGATTTCATCAAGAGCGAGCTCTCGAGAGCTCGCTCTTGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-461s1c1
Sequence:CCGGCGTACAGAATTTCGCTAAGGACTCGAGTCCTTAGCGAAATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-482s1c1
Sequence:CCGGGTTTGTGATCAGTGATCGGAACTCGAGTTCCGATCACTGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021149
VALIDATED
COTL1 MISSION shRNA Lentiviral Transduction Particles
coactosin-like 1 (Dictyostelium)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-482s21c1
Sequence:CCGGGTTTGTGATCAGTGATCGGAACTCGAGTTCCGATCACTGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-461s21c1
Sequence:CCGGCGTACAGAATTTCGCTAAGGACTCGAGTCCTTAGCGAAATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-515s21c1
Sequence:CCGGAGATTTCATCAAGAGCGAGCTCTCGAGAGCTCGCTCTTGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-356s21c1
Sequence:CCGGCATGAGCAAGAGGTCCAAGTTCTCGAGAACTTGGACCTCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_021149.2-784s21c1
Sequence:CCGGCCTCTTTCTTTGATCTTCTTTCTCGAGAAAGAAGATCAAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-784s1c1
Sequence:CCGGCCTCTTTCTTTGATCTTCTTTCTCGAGAAAGAAGATCAAAGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-356s1c1
Sequence:CCGGCATGAGCAAGAGGTCCAAGTTCTCGAGAACTTGGACCTCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-515s1c1
Sequence:CCGGAGATTTCATCAAGAGCGAGCTCTCGAGAGCTCGCTCTTGATGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-461s1c1
Sequence:CCGGCGTACAGAATTTCGCTAAGGACTCGAGTCCTTAGCGAAATTCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_021149.2-482s1c1
Sequence:CCGGGTTTGTGATCAGTGATCGGAACTCGAGTTCCGATCACTGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks