EMAIL THIS PAGE TO A FRIEND

COX10

cytochrome c oxidase assembly homolog 10 (yeast)

53 Gene Product Result for
UniProtKB ID: Q12887, B2R6U5, O15334, Q969F7
Gene ID:
Human(1352) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes heme A:farnesyltransferase, which is not a structural subunit but required for the expression of functional COX and functions in the maturation of the heme A prosthetic group of COX. This protein is predicted to contain 7-9 transmembrane domains localized in the mitochondrial inner membrane. A gene mutation, which results in the substitution of a lysine for an asparagine (N204K), is identified to be responsible for cytochrome c oxidase deficiency. In addition, this gene is disrupted in patients with CMT1A (Charcot-Marie-Tooth type 1A) duplication and with HNPP (hereditary neuropathy with liability to pressure palsies) deletion. [provided by RefSeq, Jul 2008]
Mouse(70383) cytochrome c oxidase assembly protein 10
Rat(363617) COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
Zebrafish(553384) cytochrome c oxidase assembly homolog 10 (yeast)
Thale Cress(819059) protoheme IX farnesyltransferase
cow(511440) COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
Horse(100073118) COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
dog(489515) COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
chicken(417329) COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
domestic guinea pig(100732273) COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001303 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001303 Rosetta Predictions human pricing
XM_343910 Rosetta Predictions rat pricing
NM_178379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100830 predicted 642
2 SASI_Hs01_00100831 predicted 1125
3 SASI_Hs01_00100833 predicted 1392
4 SASI_Hs02_00331577 predicted 633
5 SASI_Hs01_00100834 predicted 321
6 SASI_Hs01_00100835 predicted 847
7 SASI_Hs02_00331578 predicted 302
8 SASI_Hs01_00100836 predicted 475
9 SASI_Hs01_00100837 predicted 845
10 SASI_Hs01_00100838 predicted 338
11 SASI_Hs01_00100832 predicted 1132
12 SASI_Hs01_00100839 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170700 predicted 1355
2 SASI_Rn01_00170701 predicted 631
3 SASI_Rn01_00170702 predicted 882
4 SASI_Rn01_00170703 predicted 982
5 SASI_Rn01_00170704 predicted 1546
6 SASI_Rn01_00170705 predicted 1100
7 SASI_Rn01_00170706 predicted 912
8 SASI_Rn01_00170707 predicted 1278
9 SASI_Rn01_00170708 predicted 655
10 SASI_Rn01_00170709 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172849 predicted 714
2 SASI_Mm01_00172850 predicted 735
3 SASI_Mm01_00172851 predicted 648
4 SASI_Mm02_00348778 predicted 1235
5 SASI_Mm01_00172852 predicted 684
6 SASI_Mm01_00172853 predicted 1058
7 SASI_Mm01_00172854 predicted 861
8 SASI_Mm02_00348779 predicted 984
9 SASI_Mm01_00172855 predicted 679
10 SASI_Mm01_00172856 predicted 239
11 SASI_Mm01_00172857 predicted 318
12 SASI_Mm01_00172858 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178379
VALIDATED
COX10 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 10 (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-1480s1c1
Sequence:CCGGGCAAAGAGAGTTGGATGGTGTCTCGAGACACCATCCAACTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-292s1c1
Sequence:CCGGCTTTCCTTGAACACACGTCTTCTCGAGAAGACGTGTGTTCAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-682s1c1
Sequence:CCGGCGTTCGACTCAAACATGAATACTCGAGTATTCATGTTTGAGTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-681s1c1
Sequence:CCGGCCGTTCGACTCAAACATGAATCTCGAGATTCATGTTTGAGTCGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-992s1c2
Sequence:CCGGGATCCTGTACTCCTGGCAATTCTCGAGAATTGCCAGGAGTACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178379
VALIDATED
COX10 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 10 (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-1480s1c1
Sequence:CCGGGCAAAGAGAGTTGGATGGTGTCTCGAGACACCATCCAACTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-292s1c1
Sequence:CCGGCTTTCCTTGAACACACGTCTTCTCGAGAAGACGTGTGTTCAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-682s1c1
Sequence:CCGGCGTTCGACTCAAACATGAATACTCGAGTATTCATGTTTGAGTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-681s1c1
Sequence:CCGGCCGTTCGACTCAAACATGAATCTCGAGATTCATGTTTGAGTCGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-992s1c2
Sequence:CCGGGATCCTGTACTCCTGGCAATTCTCGAGAATTGCCAGGAGTACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178379
VALIDATED
COX10 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 10 (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-1480s1c1
Sequence:CCGGGCAAAGAGAGTTGGATGGTGTCTCGAGACACCATCCAACTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-292s1c1
Sequence:CCGGCTTTCCTTGAACACACGTCTTCTCGAGAAGACGTGTGTTCAAGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-682s1c1
Sequence:CCGGCGTTCGACTCAAACATGAATACTCGAGTATTCATGTTTGAGTCGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-681s1c1
Sequence:CCGGCCGTTCGACTCAAACATGAATCTCGAGATTCATGTTTGAGTCGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178379.2-992s1c2
Sequence:CCGGGATCCTGTACTCCTGGCAATTCTCGAGAATTGCCAGGAGTACAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001303
VALIDATED
COX10 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 10 (yeast)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-811s1c1
Sequence:CCGGGCCAACTCCATCAATCAGTTTCTCGAGAAACTGATTGATGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-519s1c1
Sequence:CCGGCAGCCTATCTTTGTCCAGAAACTCGAGTTTCTGGACAAAGATAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-589s1c1
Sequence:CCGGGACTCAATAGATGTAGGGAAACTCGAGTTTCCCTACATCTATTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001303.2-652s1c1
Sequence:CCGGGTGTATGATTTGCCAGGAATTCTCGAGAATTCCTGGCAAATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001303.3-1578s21c1
Sequence:CCGGGCGAGCATGTTGTGGTAATTCCTCGAGGAATTACCACAACATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-317s21c1
Sequence:CCGGATCTTCTCAGGAATGTCAATACTCGAGTATTGACATTCCTGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-652s21c1
Sequence:CCGGGTGTATGATTTGCCAGGAATTCTCGAGAATTCCTGGCAAATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-716s21c1
Sequence:CCGGGTACCACTGCAGCTGGATTTGCTCGAGCAAATCCAGCTGCAGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-565s21c1
Sequence:CCGGCTAGAGCCAGACTCAGTAATTCTCGAGAATTACTGAGTCTGGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001303
VALIDATED
COX10 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 10 (yeast)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-811s1c1
Sequence:CCGGGCCAACTCCATCAATCAGTTTCTCGAGAAACTGATTGATGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-519s1c1
Sequence:CCGGCAGCCTATCTTTGTCCAGAAACTCGAGTTTCTGGACAAAGATAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-589s1c1
Sequence:CCGGGACTCAATAGATGTAGGGAAACTCGAGTTTCCCTACATCTATTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001303.2-652s1c1
Sequence:CCGGGTGTATGATTTGCCAGGAATTCTCGAGAATTCCTGGCAAATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001303.3-1578s21c1
Sequence:CCGGGCGAGCATGTTGTGGTAATTCCTCGAGGAATTACCACAACATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-317s21c1
Sequence:CCGGATCTTCTCAGGAATGTCAATACTCGAGTATTGACATTCCTGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-652s21c1
Sequence:CCGGGTGTATGATTTGCCAGGAATTCTCGAGAATTCCTGGCAAATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-716s21c1
Sequence:CCGGGTACCACTGCAGCTGGATTTGCTCGAGCAAATCCAGCTGCAGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-565s21c1
Sequence:CCGGCTAGAGCCAGACTCAGTAATTCTCGAGAATTACTGAGTCTGGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001303
VALIDATED
COX10 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 10 (yeast)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-811s1c1
Sequence:CCGGGCCAACTCCATCAATCAGTTTCTCGAGAAACTGATTGATGGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-519s1c1
Sequence:CCGGCAGCCTATCTTTGTCCAGAAACTCGAGTTTCTGGACAAAGATAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001303.2-589s1c1
Sequence:CCGGGACTCAATAGATGTAGGGAAACTCGAGTTTCCCTACATCTATTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001303.2-652s1c1
Sequence:CCGGGTGTATGATTTGCCAGGAATTCTCGAGAATTCCTGGCAAATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001303.3-1578s21c1
Sequence:CCGGGCGAGCATGTTGTGGTAATTCCTCGAGGAATTACCACAACATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-317s21c1
Sequence:CCGGATCTTCTCAGGAATGTCAATACTCGAGTATTGACATTCCTGAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-652s21c1
Sequence:CCGGGTGTATGATTTGCCAGGAATTCTCGAGAATTCCTGGCAAATCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-716s21c1
Sequence:CCGGGTACCACTGCAGCTGGATTTGCTCGAGCAAATCCAGCTGCAGTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001303.3-565s21c1
Sequence:CCGGCTAGAGCCAGACTCAGTAATTCTCGAGAATTACTGAGTCTGGCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks