EMAIL THIS PAGE TO A FRIEND

COX11

cytochrome c oxidase assembly homolog 11 (yeast)

52 Gene Product Result for
Synonyms: COX11P
UniProtKB ID: Q9Y6N1, D3DTY5, I3L220, Q6FHB7, Q9BRX0, Q9UME8
Gene ID:
Human(1353) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009]
Mouse(69802) cytochrome c oxidase assembly protein 11
Rat(690300) cytochrome c oxidase assembly homolog 11 (yeast)
Zebrafish(100005158) COX11 cytochrome c oxidase assembly homolog (yeast)
chicken(770638) COX11 cytochrome c oxidase assembly homolog (yeast)
cow(510509) COX11 cytochrome c oxidase assembly homolog (yeast)
dog(609555) COX11 cytochrome c oxidase assembly homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004375 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004375 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004375 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109301 MISSION® esiRNA esiRNA human COX11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004375 Rosetta Predictions human pricing
NM_001109575 Rosetta Predictions rat pricing
NM_199008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040249 predicted 1318
2 SASI_Hs02_00337458 predicted 479
3 SASI_Hs01_00040250 predicted 1376
4 SASI_Hs01_00040251 predicted 262
5 SASI_Hs01_00040252 predicted 601
6 SASI_Hs01_00040253 predicted 1282
7 SASI_Hs01_00040254 predicted 608
8 SASI_Hs01_00040255 predicted 618
9 SASI_Hs02_00337459 predicted 260
10 SASI_Hs01_00040256 predicted 1269
11 SASI_Hs01_00040257 predicted 611
12 SASI_Hs01_00040258 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249741 predicted 773
2 SASI_Rn02_00249742 predicted 443
3 SASI_Rn02_00249743 predicted 626
4 SASI_Rn02_00249744 predicted 452
5 SASI_Rn02_00249745 predicted 746
6 SASI_Rn02_00249746 predicted 592
7 SASI_Rn02_00249747 predicted 606
8 SASI_Rn02_00249748 predicted 579
9 SASI_Rn02_00249749 predicted 755
10 SASI_Rn02_00249750 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351255 predicted 759
2 SASI_Mm01_00169502 predicted 886
3 SASI_Mm01_00169504 predicted 614
4 SASI_Mm01_00169505 predicted 577
5 SASI_Mm02_00351256 predicted 560
6 SASI_Mm01_00169511 predicted 870
7 SASI_Mm02_00351257 predicted 561
8 SASI_Mm02_00351258 predicted 414
9 SASI_Mm02_00351259 predicted 814
10 SASI_Mm02_00351260 predicted 897
11 SASI_Mm01_00169503 predicted 752
12 SASI_Mm01_00169506 predicted 639
13 SASI_Mm01_00169507 predicted 615
14 SASI_Mm01_00169508 predicted 444
15 SASI_Mm01_00169509 predicted 627
16 SASI_Mm01_00169510 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004375
VALIDATED
COX11 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 11 (yeast)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-477s1c1
Sequence:CCGGCCTGTTAAAGATCGAATCATTCTCGAGAATGATTCGATCTTTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-615s1c1
Sequence:CCGGCCTACTGACAAACCAGTAATTCTCGAGAATTACTGGTTTGTCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-669s1c1
Sequence:CCGGGCTGGACAGTATTTCAATAAACTCGAGTTTATTGAAATACTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-853s1c1
Sequence:CCGGAGTTGCCAGTTCCAGGATATACTCGAGTATATCCTGGAACTGGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-549s1c1
Sequence:CCGGCCTCAGCAAACAGAAATATATCTCGAGATATATTTCTGTTTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004375
VALIDATED
COX11 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 11 (yeast)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-477s1c1
Sequence:CCGGCCTGTTAAAGATCGAATCATTCTCGAGAATGATTCGATCTTTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-615s1c1
Sequence:CCGGCCTACTGACAAACCAGTAATTCTCGAGAATTACTGGTTTGTCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-669s1c1
Sequence:CCGGGCTGGACAGTATTTCAATAAACTCGAGTTTATTGAAATACTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-853s1c1
Sequence:CCGGAGTTGCCAGTTCCAGGATATACTCGAGTATATCCTGGAACTGGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-549s1c1
Sequence:CCGGCCTCAGCAAACAGAAATATATCTCGAGATATATTTCTGTTTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004375
VALIDATED
COX11 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 11 (yeast)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-477s1c1
Sequence:CCGGCCTGTTAAAGATCGAATCATTCTCGAGAATGATTCGATCTTTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-615s1c1
Sequence:CCGGCCTACTGACAAACCAGTAATTCTCGAGAATTACTGGTTTGTCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-669s1c1
Sequence:CCGGGCTGGACAGTATTTCAATAAACTCGAGTTTATTGAAATACTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-853s1c1
Sequence:CCGGAGTTGCCAGTTCCAGGATATACTCGAGTATATCCTGGAACTGGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004375.2-549s1c1
Sequence:CCGGCCTCAGCAAACAGAAATATATCTCGAGATATATTTCTGTTTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199008
VALIDATED
COX11 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 11 (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199008.1-980s1c1
Sequence:CCGGGCACCTTCATTTATCCCACTTCTCGAGAAGTGGGATAAATGAAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-770s1c1
Sequence:CCGGCGACCTCATCACTCTTTCTTACTCGAGTAAGAAAGAGTGATGAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-627s1c1
Sequence:CCGGCCGTTTGAAGCTGGACAGTATCTCGAGATACTGTCCAGCTTCAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-444s1c1
Sequence:CCGGCCTGTCAAGGACCGGGTCATTCTCGAGAATGACCCGGTCCTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-468s1c1
Sequence:CCGGGTCACCTTCAATGCTGACGTTCTCGAGAACGTCAGCATTGAAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199008
VALIDATED
COX11 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 11 (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199008.1-980s1c1
Sequence:CCGGGCACCTTCATTTATCCCACTTCTCGAGAAGTGGGATAAATGAAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-770s1c1
Sequence:CCGGCGACCTCATCACTCTTTCTTACTCGAGTAAGAAAGAGTGATGAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-627s1c1
Sequence:CCGGCCGTTTGAAGCTGGACAGTATCTCGAGATACTGTCCAGCTTCAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-444s1c1
Sequence:CCGGCCTGTCAAGGACCGGGTCATTCTCGAGAATGACCCGGTCCTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-468s1c1
Sequence:CCGGGTCACCTTCAATGCTGACGTTCTCGAGAACGTCAGCATTGAAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199008
VALIDATED
COX11 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 11 (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199008.1-980s1c1
Sequence:CCGGGCACCTTCATTTATCCCACTTCTCGAGAAGTGGGATAAATGAAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-770s1c1
Sequence:CCGGCGACCTCATCACTCTTTCTTACTCGAGTAAGAAAGAGTGATGAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-627s1c1
Sequence:CCGGCCGTTTGAAGCTGGACAGTATCTCGAGATACTGTCCAGCTTCAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-444s1c1
Sequence:CCGGCCTGTCAAGGACCGGGTCATTCTCGAGAATGACCCGGTCCTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199008.1-468s1c1
Sequence:CCGGGTCACCTTCAATGCTGACGTTCTCGAGAACGTCAGCATTGAAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)