EMAIL THIS PAGE TO A FRIEND

COX14

cytochrome c oxidase assembly homolog 14 (S. cerevisiae)

50 Gene Product Result for
Synonyms: C12orf62
UniProtKB ID: Q96I36, B2R5G6
Gene ID:
Human(84987) Summary: This gene encodes a small single-pass transmembrane protein that localizes to mitochondria. This protein may play a role in coordinating the early steps of cytochrome c oxidase (COX; also known as complex IV) subunit assembly and, in particular, the synthesis and assembly of the COX I subunit of the holoenzyme. Mutations in this gene have been associated with mitochondrial complex IV deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(66379) cytochrome c oxidase assembly protein 14
Rat(681219) COX14 cytochrome c oxidase assembly
Zebrafish(568423) cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
cow(768048) COX14 cytochrome c oxidase assembly homolog (S. cerevisiae)
dog(100688544) COX14 cytochrome c oxidase assembly homolog (S. cerevisiae)
chicken(426880) COX14 cytochrome c oxidase assembly homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032901 Rosetta Predictions human pricing
XM_001060794 Rosetta Predictions rat pricing
NM_183256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211552 predicted 212
2 SASI_Hs01_00211553 predicted 197
3 SASI_Hs01_00211554 predicted 285
4 SASI_Hs02_00360524 predicted 284
5 SASI_Hs01_00211556 predicted 339
6 SASI_Hs01_00211557 predicted 223
7 SASI_Hs01_00211558 predicted 278
8 SASI_Hs01_00211559 predicted 203
9 SASI_Hs01_00211560 predicted 279
10 SASI_Hs01_00211561 predicted 232
11 SASI_Hs01_00211555 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060794 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297751 predicted 65
2 SASI_Rn02_00297752 predicted 39
3 SASI_Rn02_00297753 predicted 55
4 SASI_Rn02_00297754 predicted 41
5 SASI_Rn02_00297755 predicted 145
6 SASI_Rn02_00297756 predicted 65
7 SASI_Rn02_00297757 predicted 108
8 SASI_Rn02_00297758 predicted 106
9 SASI_Rn02_00297759 predicted 44
10 SASI_Rn02_00297760 predicted 144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020186 predicted 261
2 SASI_Mm02_00350337 predicted 226
3 SASI_Mm01_00020187 predicted 400
4 SASI_Mm01_00020188 predicted 226
5 SASI_Mm01_00020189 predicted 244
6 SASI_Mm01_00020190 predicted 400
7 SASI_Mm01_00020192 predicted 430
8 SASI_Mm01_00020193 predicted 242
9 SASI_Mm01_00020194 predicted 249
10 SASI_Mm01_00020195 predicted 209
11 SASI_Mm01_00020191 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032901
VALIDATED
COX14 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-247s1c1
Sequence:CCGGCATGATGCTTCTCACTGTGTACTCGAGTACACAGTGAGAAGCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-338s1c1
Sequence:CCGGGAAGAACAGAAGACCTCAGGACTCGAGTCCTGAGGTCTTCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-336s1c1
Sequence:CCGGCAGAAGAACAGAAGACCTCAGCTCGAGCTGAGGTCTTCTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-335s1c1
Sequence:CCGGGCAGAAGAACAGAAGACCTCACTCGAGTGAGGTCTTCTGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-246s1c1
Sequence:CCGGCCATGATGCTTCTCACTGTGTCTCGAGACACAGTGAGAAGCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-235s1c1
Sequence:CCGGCTTCTCTACCTCCATGATGCTCTCGAGAGCATCATGGAGGTAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-289s1c1
Sequence:CCGGCCGAGTCTACCACTATTTCCACTCGAGTGGAAATAGTGGTAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032901.2-287s1c1
Sequence:CCGGGTCCGAGTCTACCACTATTTCCTCGAGGAAATAGTGGTAGACTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-232s1c1
Sequence:CCGGGACCTTCTCTACCTCCATGATCTCGAGATCATGGAGGTAGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-232s21c1
Sequence:CCGGGACCTTCTCTACCTCCATGATCTCGAGATCATGGAGGTAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-247s21c1
Sequence:CCGGCATGATGCTTCTCACTGTGTACTCGAGTACACAGTGAGAAGCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032901.2-446s21c1
Sequence:CCGGCAACAGGACTAGAGCGTTGATCTCGAGATCAACGCTCTAGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-289s21c1
Sequence:CCGGCCGAGTCTACCACTATTTCCACTCGAGTGGAAATAGTGGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032901
VALIDATED
COX14 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-247s1c1
Sequence:CCGGCATGATGCTTCTCACTGTGTACTCGAGTACACAGTGAGAAGCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-338s1c1
Sequence:CCGGGAAGAACAGAAGACCTCAGGACTCGAGTCCTGAGGTCTTCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-336s1c1
Sequence:CCGGCAGAAGAACAGAAGACCTCAGCTCGAGCTGAGGTCTTCTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-335s1c1
Sequence:CCGGGCAGAAGAACAGAAGACCTCACTCGAGTGAGGTCTTCTGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-246s1c1
Sequence:CCGGCCATGATGCTTCTCACTGTGTCTCGAGACACAGTGAGAAGCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-235s1c1
Sequence:CCGGCTTCTCTACCTCCATGATGCTCTCGAGAGCATCATGGAGGTAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-289s1c1
Sequence:CCGGCCGAGTCTACCACTATTTCCACTCGAGTGGAAATAGTGGTAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032901.2-287s1c1
Sequence:CCGGGTCCGAGTCTACCACTATTTCCTCGAGGAAATAGTGGTAGACTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-232s1c1
Sequence:CCGGGACCTTCTCTACCTCCATGATCTCGAGATCATGGAGGTAGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-232s21c1
Sequence:CCGGGACCTTCTCTACCTCCATGATCTCGAGATCATGGAGGTAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-247s21c1
Sequence:CCGGCATGATGCTTCTCACTGTGTACTCGAGTACACAGTGAGAAGCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032901.2-446s21c1
Sequence:CCGGCAACAGGACTAGAGCGTTGATCTCGAGATCAACGCTCTAGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-289s21c1
Sequence:CCGGCCGAGTCTACCACTATTTCCACTCGAGTGGAAATAGTGGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032901
VALIDATED
COX14 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-247s1c1
Sequence:CCGGCATGATGCTTCTCACTGTGTACTCGAGTACACAGTGAGAAGCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-338s1c1
Sequence:CCGGGAAGAACAGAAGACCTCAGGACTCGAGTCCTGAGGTCTTCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-336s1c1
Sequence:CCGGCAGAAGAACAGAAGACCTCAGCTCGAGCTGAGGTCTTCTGTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-335s1c1
Sequence:CCGGGCAGAAGAACAGAAGACCTCACTCGAGTGAGGTCTTCTGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-246s1c1
Sequence:CCGGCCATGATGCTTCTCACTGTGTCTCGAGACACAGTGAGAAGCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032901.2-235s1c1
Sequence:CCGGCTTCTCTACCTCCATGATGCTCTCGAGAGCATCATGGAGGTAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-289s1c1
Sequence:CCGGCCGAGTCTACCACTATTTCCACTCGAGTGGAAATAGTGGTAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032901.2-287s1c1
Sequence:CCGGGTCCGAGTCTACCACTATTTCCTCGAGGAAATAGTGGTAGACTCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032901.2-232s1c1
Sequence:CCGGGACCTTCTCTACCTCCATGATCTCGAGATCATGGAGGTAGAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-232s21c1
Sequence:CCGGGACCTTCTCTACCTCCATGATCTCGAGATCATGGAGGTAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-247s21c1
Sequence:CCGGCATGATGCTTCTCACTGTGTACTCGAGTACACAGTGAGAAGCATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032901.2-446s21c1
Sequence:CCGGCAACAGGACTAGAGCGTTGATCTCGAGATCAACGCTCTAGTCCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032901.2-289s21c1
Sequence:CCGGCCGAGTCTACCACTATTTCCACTCGAGTGGAAATAGTGGTAGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183256
VALIDATED
COX14 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-392s21c1
Sequence:CCGGGAAGACCTCAGGAGTCCTGTACTCGAGTACAGGACTCCTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-330s21c1
Sequence:CCGGAGTGTACGAGCCTACCGTTACCTCGAGGTAACGGTAGGCTCGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-248s21c1
Sequence:CCGGTGCCAAGCAGCTAGCCGATATCTCGAGATATCGGCTAGCTGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-278s21c1
Sequence:CCGGGACCTTCTCTGCCTCGATGATCTCGAGATCATCGAGGCAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-548s21c1
Sequence:CCGGGTGCCGTTCTGACAGTTTATGCTCGAGCATAAACTGTCAGAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183256
VALIDATED
COX14 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-392s21c1
Sequence:CCGGGAAGACCTCAGGAGTCCTGTACTCGAGTACAGGACTCCTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-330s21c1
Sequence:CCGGAGTGTACGAGCCTACCGTTACCTCGAGGTAACGGTAGGCTCGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-248s21c1
Sequence:CCGGTGCCAAGCAGCTAGCCGATATCTCGAGATATCGGCTAGCTGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-278s21c1
Sequence:CCGGGACCTTCTCTGCCTCGATGATCTCGAGATCATCGAGGCAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-548s21c1
Sequence:CCGGGTGCCGTTCTGACAGTTTATGCTCGAGCATAAACTGTCAGAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183256
VALIDATED
COX14 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 14 (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-392s21c1
Sequence:CCGGGAAGACCTCAGGAGTCCTGTACTCGAGTACAGGACTCCTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-330s21c1
Sequence:CCGGAGTGTACGAGCCTACCGTTACCTCGAGGTAACGGTAGGCTCGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-248s21c1
Sequence:CCGGTGCCAAGCAGCTAGCCGATATCTCGAGATATCGGCTAGCTGCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-278s21c1
Sequence:CCGGGACCTTCTCTGCCTCGATGATCTCGAGATCATCGAGGCAGAGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_183256.3-548s21c1
Sequence:CCGGGTGCCGTTCTGACAGTTTATGCTCGAGCATAAACTGTCAGAACGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks