EMAIL THIS PAGE TO A FRIEND

COX15

cytochrome c oxidase assembly homolog 15 (yeast)

Synonyms: CEMCOX2
Gene ID:
Human(1355) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008]
Mouse(226139) cytochrome c oxidase assembly protein 15
Rat(309391) cytochrome c oxidase assembly homolog 15 (yeast)
sheep(100170322) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
domestic guinea pig(100725081) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
Zebrafish(394181) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
cow(517811) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
Horse(100060721) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
chicken(423830) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
dog(477792) COX15 homolog, cytochrome c oxidase assembly protein (yeast)
Thale Cress(835708) cytochrome c oxidase assembly protein COX15
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004376 Rosetta Predictions human pricing
NM_078470 Rosetta Predictions human pricing
NM_001033699 Rosetta Predictions rat pricing
NM_144874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112165 predicted 1331
2 SASI_Hs01_00112166 predicted 1293
3 SASI_Hs01_00112167 predicted 723
4 SASI_Hs02_00337460 predicted 692
5 SASI_Hs02_00337461 predicted 654
6 SASI_Hs01_00112168 predicted 732
7 SASI_Hs01_00112169 predicted 1295
8 SASI_Hs01_00112170 predicted 785
9 SASI_Hs01_00112171 predicted 742
10 SASI_Hs01_00112173 predicted 748
11 SASI_Hs01_00112164 predicted 458
12 SASI_Hs01_00112172 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_078470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149485 predicted 1329
2 SASI_Hs01_00149486 predicted 1296
3 SASI_Hs01_00149487 predicted 718
4 SASI_Hs02_00362152 predicted 692
5 SASI_Hs02_00362153 predicted 651
6 SASI_Hs01_00149488 predicted 733
7 SASI_Hs01_00149489 predicted 1296
8 SASI_Hs01_00149490 predicted 780
9 SASI_Hs01_00149491 predicted 741
10 SASI_Hs01_00149493 predicted 741
11 SASI_Hs01_00149484 predicted 466
12 SASI_Hs01_00149492 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090713 predicted 363
2 SASI_Rn01_00090715 predicted 191
3 SASI_Rn01_00090716 predicted 1061
4 SASI_Rn01_00090717 predicted 430
5 SASI_Rn02_00203731 predicted 644
6 SASI_Rn01_00090718 predicted 1151
7 SASI_Rn01_00090719 predicted 1074
8 SASI_Rn02_00203732 predicted 944
9 SASI_Rn01_00090720 predicted 697
10 SASI_Rn01_00090721 predicted 1259
11 SASI_Rn01_00090714 predicted 1190
12 SASI_Rn01_00090722 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076951 predicted 1462
2 SASI_Mm01_00076952 predicted 1082
3 SASI_Mm01_00076953 predicted 1182
4 SASI_Mm01_00076954 predicted 1392
5 SASI_Mm01_00076955 predicted 1427
6 SASI_Mm01_00076956 predicted 655
7 SASI_Mm01_00076957 predicted 1412
8 SASI_Mm01_00076959 predicted 704
9 SASI_Mm01_00076960 predicted 1090
10 SASI_Mm02_00340320 predicted 638
11 SASI_Mm01_00076958 predicted 1574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144874
VALIDATED
COX15 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 15 (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-493s21c1
Sequence:CCGGGCTGGCGGAATTCAAGTTTATCTCGAGATAAACTTGAATTCCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-661s21c1
Sequence:CCGGGGGTCTGTTGGGTTGGTATATCTCGAGATATACCAACCCAACAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-818s21c1
Sequence:CCGGCCTCAGCACAAGTTACCAGAACTCGAGTTCTGGTAACTTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144874.3-1346s21c1
Sequence:CCGGCCTTGGAAACTCATCACCAAACTCGAGTTTGGTGATGAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-1347s1c1
Sequence:CCGGCCTTGGAAACTCATCACCAAACTCGAGTTTGGTGATGAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-819s1c1
Sequence:CCGGCCTCAGCACAAGTTACCAGAACTCGAGTTCTGGTAACTTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-494s1c1
Sequence:CCGGGCTGGCGGAATTCAAGTTTATCTCGAGATAAACTTGAATTCCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-1289s1c1
Sequence:CCGGTGAACTCCGAAGAGTCCCTAACTCGAGTTAGGGACTCTTCGGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144874.2-1124s1c1
Sequence:CCGGCCTTCCTCGAAGAACCAAGATCTCGAGATCTTGGTTCTTCGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144874
VALIDATED
COX15 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 15 (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-493s21c1
Sequence:CCGGGCTGGCGGAATTCAAGTTTATCTCGAGATAAACTTGAATTCCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-661s21c1
Sequence:CCGGGGGTCTGTTGGGTTGGTATATCTCGAGATATACCAACCCAACAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-818s21c1
Sequence:CCGGCCTCAGCACAAGTTACCAGAACTCGAGTTCTGGTAACTTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144874.3-1346s21c1
Sequence:CCGGCCTTGGAAACTCATCACCAAACTCGAGTTTGGTGATGAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-1347s1c1
Sequence:CCGGCCTTGGAAACTCATCACCAAACTCGAGTTTGGTGATGAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-819s1c1
Sequence:CCGGCCTCAGCACAAGTTACCAGAACTCGAGTTCTGGTAACTTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-494s1c1
Sequence:CCGGGCTGGCGGAATTCAAGTTTATCTCGAGATAAACTTGAATTCCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-1289s1c1
Sequence:CCGGTGAACTCCGAAGAGTCCCTAACTCGAGTTAGGGACTCTTCGGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144874.2-1124s1c1
Sequence:CCGGCCTTCCTCGAAGAACCAAGATCTCGAGATCTTGGTTCTTCGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144874
VALIDATED
COX15 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 15 (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-493s21c1
Sequence:CCGGGCTGGCGGAATTCAAGTTTATCTCGAGATAAACTTGAATTCCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-661s21c1
Sequence:CCGGGGGTCTGTTGGGTTGGTATATCTCGAGATATACCAACCCAACAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144874.3-818s21c1
Sequence:CCGGCCTCAGCACAAGTTACCAGAACTCGAGTTCTGGTAACTTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144874.3-1346s21c1
Sequence:CCGGCCTTGGAAACTCATCACCAAACTCGAGTTTGGTGATGAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-1347s1c1
Sequence:CCGGCCTTGGAAACTCATCACCAAACTCGAGTTTGGTGATGAGTTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-819s1c1
Sequence:CCGGCCTCAGCACAAGTTACCAGAACTCGAGTTCTGGTAACTTGTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-494s1c1
Sequence:CCGGGCTGGCGGAATTCAAGTTTATCTCGAGATAAACTTGAATTCCGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144874.2-1289s1c1
Sequence:CCGGTGAACTCCGAAGAGTCCCTAACTCGAGTTAGGGACTCTTCGGAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144874.2-1124s1c1
Sequence:CCGGCCTTCCTCGAAGAACCAAGATCTCGAGATCTTGGTTCTTCGAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004376
VALIDATED
COX15 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 15 (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-1386s21c1
Sequence:CCGGCTCCTACAGTTGAGACGATTTCTCGAGAAATCGTCTCAACTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004376.5-2223s21c1
Sequence:CCGGGTGAAGGAACTAGGGATATTTCTCGAGAAATATCCCTAGTTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-1466s21c1
Sequence:CCGGGCTAGATGCTGGGCTTGTTTACTCGAGTAAACAAGCCCAGCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004376.5-864s21c1
Sequence:CCGGGCAGTTATTCTTGGTGGAGTACTCGAGTACTCCACCAAGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-908s21c1
Sequence:CCGGCTCGATGGTAGATTGGCATTTCTCGAGAAATGCCAATCTACCATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-1197s1c1
Sequence:CCGGGCCCTGTCTTATTCAACTTTACTCGAGTAAAGTTGAATAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-1138s1c1
Sequence:CCGGCCTTCCTAGAAGGACCAAGATCTCGAGATCTTGGTCCTTCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004376.3-626s1c1
Sequence:CCGGCGTGGCATGAAAGGACGTGTTCTCGAGAACACGTCCTTTCATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-341s1c1
Sequence:CCGGGCAGTTATTCTTGGTGGAGTACTCGAGTACTCCACCAAGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-863s1c1
Sequence:CCGGCTCCTACAGTTGAGACGATTTCTCGAGAAATCGTCTCAACTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004376
VALIDATED
COX15 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 15 (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-1386s21c1
Sequence:CCGGCTCCTACAGTTGAGACGATTTCTCGAGAAATCGTCTCAACTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004376.5-2223s21c1
Sequence:CCGGGTGAAGGAACTAGGGATATTTCTCGAGAAATATCCCTAGTTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-1466s21c1
Sequence:CCGGGCTAGATGCTGGGCTTGTTTACTCGAGTAAACAAGCCCAGCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004376.5-864s21c1
Sequence:CCGGGCAGTTATTCTTGGTGGAGTACTCGAGTACTCCACCAAGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-908s21c1
Sequence:CCGGCTCGATGGTAGATTGGCATTTCTCGAGAAATGCCAATCTACCATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-1197s1c1
Sequence:CCGGGCCCTGTCTTATTCAACTTTACTCGAGTAAAGTTGAATAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-1138s1c1
Sequence:CCGGCCTTCCTAGAAGGACCAAGATCTCGAGATCTTGGTCCTTCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004376.3-626s1c1
Sequence:CCGGCGTGGCATGAAAGGACGTGTTCTCGAGAACACGTCCTTTCATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-341s1c1
Sequence:CCGGGCAGTTATTCTTGGTGGAGTACTCGAGTACTCCACCAAGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-863s1c1
Sequence:CCGGCTCCTACAGTTGAGACGATTTCTCGAGAAATCGTCTCAACTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004376
VALIDATED
COX15 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 15 (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-1386s21c1
Sequence:CCGGCTCCTACAGTTGAGACGATTTCTCGAGAAATCGTCTCAACTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004376.5-2223s21c1
Sequence:CCGGGTGAAGGAACTAGGGATATTTCTCGAGAAATATCCCTAGTTCCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-1466s21c1
Sequence:CCGGGCTAGATGCTGGGCTTGTTTACTCGAGTAAACAAGCCCAGCATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004376.5-864s21c1
Sequence:CCGGGCAGTTATTCTTGGTGGAGTACTCGAGTACTCCACCAAGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004376.5-908s21c1
Sequence:CCGGCTCGATGGTAGATTGGCATTTCTCGAGAAATGCCAATCTACCATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-1197s1c1
Sequence:CCGGGCCCTGTCTTATTCAACTTTACTCGAGTAAAGTTGAATAAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-1138s1c1
Sequence:CCGGCCTTCCTAGAAGGACCAAGATCTCGAGATCTTGGTCCTTCTAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004376.3-626s1c1
Sequence:CCGGCGTGGCATGAAAGGACGTGTTCTCGAGAACACGTCCTTTCATGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-341s1c1
Sequence:CCGGGCAGTTATTCTTGGTGGAGTACTCGAGTACTCCACCAAGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004376.3-863s1c1
Sequence:CCGGCTCCTACAGTTGAGACGATTTCTCGAGAAATCGTCTCAACTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks