EMAIL THIS PAGE TO A FRIEND

COX16

COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)

45 Gene Product Result for
Synonyms: C14orf112
UniProtKB ID: Q9P0S2, A6NDT5, A8K3X8
Gene ID:
Mouse(66272) cytochrome c oxidase assembly protein 16
Rat(100302447) COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Zebrafish(550257) COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
cow(615979) COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
dog(100846976) COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
chicken(423257) COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119951 MISSION® esiRNA esiRNA human COX16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016468 Rosetta Predictions human pricing
NM_025461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244964 predicted 608
2 SASI_Hs01_00244965 predicted 541
3 SASI_Hs01_00244966 predicted 382
4 SASI_Hs01_00244968 predicted 468
5 SASI_Hs01_00244970 predicted 510
6 SASI_Hs01_00244971 predicted 516
7 SASI_Hs01_00244972 predicted 302
8 SASI_Hs01_00244973 predicted 552
9 SASI_Hs02_00349515 predicted 588
10 SASI_Hs02_00349516 predicted 593
11 SASI_Hs01_00244967 predicted 535
12 SASI_Hs01_00244969 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024642 predicted 180
2 SASI_Mm01_00024644 predicted 542
3 SASI_Mm01_00024645 predicted 762
4 SASI_Mm01_00024646 predicted 944
5 SASI_Mm01_00024647 predicted 883
6 SASI_Mm02_00328299 predicted 706
7 SASI_Mm02_00328300 predicted 270
8 SASI_Mm01_00024648 predicted 264
9 SASI_Mm01_00024649 predicted 854
10 SASI_Mm01_00024651 predicted 721
11 SASI_Mm01_00024643 predicted 758
12 SASI_Mm01_00024650 predicted 893
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016468
VALIDATED
COX16 MISSION shRNA Bacterial Glycerol Stock
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016468.3-497s1c1
Sequence:CCGGGAAAGGAAATTCCAGGCCCATCTCGAGATGGGCCTGGAATTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016468.3-124s1c1
Sequence:CCGGCAAGAACAAGACTCTCGGCTACTCGAGTAGCCGAGAGTCTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-211s21c1
Sequence:CCGGTATGATGCTGTGAAGAGTAAACTCGAGTTTACTCTTCACAGCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016468.4-403s21c1
Sequence:CCGGACAACTTGACTCTGCTGATTCCTCGAGGAATCAGCAGAGTCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-376s21c1
Sequence:GTACCGGAGAAATCCAGAAAGCCTTAAGCTCGAGCTTAAGGCTTTCTGGATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016468.4-518s21c1
Sequence:CCGGGAAACTTGGATATGGGTAATTCTCGAGAATTACCCATATCCAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-271s21c1
Sequence:CCGGATATCTTTAGAGTCGGAATATCTCGAGATATTCCGACTCTAAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016468
VALIDATED
COX16 MISSION shRNA shRNA Plasmid DNA
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016468.3-497s1c1
Sequence:CCGGGAAAGGAAATTCCAGGCCCATCTCGAGATGGGCCTGGAATTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016468.3-124s1c1
Sequence:CCGGCAAGAACAAGACTCTCGGCTACTCGAGTAGCCGAGAGTCTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-211s21c1
Sequence:CCGGTATGATGCTGTGAAGAGTAAACTCGAGTTTACTCTTCACAGCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016468.4-403s21c1
Sequence:CCGGACAACTTGACTCTGCTGATTCCTCGAGGAATCAGCAGAGTCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-376s21c1
Sequence:GTACCGGAGAAATCCAGAAAGCCTTAAGCTCGAGCTTAAGGCTTTCTGGATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016468.4-518s21c1
Sequence:CCGGGAAACTTGGATATGGGTAATTCTCGAGAATTACCCATATCCAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-271s21c1
Sequence:CCGGATATCTTTAGAGTCGGAATATCTCGAGATATTCCGACTCTAAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016468
VALIDATED
COX16 MISSION shRNA Lentiviral Transduction Particles
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016468.3-497s1c1
Sequence:CCGGGAAAGGAAATTCCAGGCCCATCTCGAGATGGGCCTGGAATTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016468.3-124s1c1
Sequence:CCGGCAAGAACAAGACTCTCGGCTACTCGAGTAGCCGAGAGTCTTGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-211s21c1
Sequence:CCGGTATGATGCTGTGAAGAGTAAACTCGAGTTTACTCTTCACAGCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016468.4-403s21c1
Sequence:CCGGACAACTTGACTCTGCTGATTCCTCGAGGAATCAGCAGAGTCAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-376s21c1
Sequence:GTACCGGAGAAATCCAGAAAGCCTTAAGCTCGAGCTTAAGGCTTTCTGGATTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016468.4-518s21c1
Sequence:CCGGGAAACTTGGATATGGGTAATTCTCGAGAATTACCCATATCCAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016468.4-271s21c1
Sequence:CCGGATATCTTTAGAGTCGGAATATCTCGAGATATTCCGACTCTAAAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025461
VALIDATED
COX16 MISSION shRNA Bacterial Glycerol Stock
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025461.2-408s1c1
Sequence:CCGGGAAGATCCTCAACTCCTCCAACTCGAGTTGGAGGAGTTGAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025461.2-941s1c1
Sequence:CCGGGCCTCTGAAACCTGTTCATATCTCGAGATATGAACAGGTTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025461.2-273s1c1
Sequence:CCGGGCTGTGACAATTAAGATTGATCTCGAGATCAATCTTAATTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025461.2-174s1c1
Sequence:CCGGCTGCGTAAGAACAAGACTCTACTCGAGTAGAGTCTTGTTCTTACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025461.5-684s21c1
Sequence:CCGGACACTCCACTACCAATCTATACTCGAGTATAGATTGGTAGTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-407s21c1
Sequence:CCGGGAAGATCCTCAACTCCTCCAACTCGAGTTGGAGGAGTTGAGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-173s21c1
Sequence:CCGGCTGCGTAAGAACAAGACTCTACTCGAGTAGAGTCTTGTTCTTACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-272s21c1
Sequence:CCGGGCTGTGACAATTAAGATTGATCTCGAGATCAATCTTAATTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025461
VALIDATED
COX16 MISSION shRNA shRNA Plasmid DNA
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025461.2-408s1c1
Sequence:CCGGGAAGATCCTCAACTCCTCCAACTCGAGTTGGAGGAGTTGAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025461.2-941s1c1
Sequence:CCGGGCCTCTGAAACCTGTTCATATCTCGAGATATGAACAGGTTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025461.2-273s1c1
Sequence:CCGGGCTGTGACAATTAAGATTGATCTCGAGATCAATCTTAATTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025461.2-174s1c1
Sequence:CCGGCTGCGTAAGAACAAGACTCTACTCGAGTAGAGTCTTGTTCTTACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025461.5-684s21c1
Sequence:CCGGACACTCCACTACCAATCTATACTCGAGTATAGATTGGTAGTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-407s21c1
Sequence:CCGGGAAGATCCTCAACTCCTCCAACTCGAGTTGGAGGAGTTGAGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-173s21c1
Sequence:CCGGCTGCGTAAGAACAAGACTCTACTCGAGTAGAGTCTTGTTCTTACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-272s21c1
Sequence:CCGGGCTGTGACAATTAAGATTGATCTCGAGATCAATCTTAATTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025461
VALIDATED
COX16 MISSION shRNA Lentiviral Transduction Particles
COX16 cytochrome c oxidase assembly homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025461.2-408s1c1
Sequence:CCGGGAAGATCCTCAACTCCTCCAACTCGAGTTGGAGGAGTTGAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025461.2-941s1c1
Sequence:CCGGGCCTCTGAAACCTGTTCATATCTCGAGATATGAACAGGTTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025461.2-273s1c1
Sequence:CCGGGCTGTGACAATTAAGATTGATCTCGAGATCAATCTTAATTGTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025461.2-174s1c1
Sequence:CCGGCTGCGTAAGAACAAGACTCTACTCGAGTAGAGTCTTGTTCTTACGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025461.5-684s21c1
Sequence:CCGGACACTCCACTACCAATCTATACTCGAGTATAGATTGGTAGTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-407s21c1
Sequence:CCGGGAAGATCCTCAACTCCTCCAACTCGAGTTGGAGGAGTTGAGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-173s21c1
Sequence:CCGGCTGCGTAAGAACAAGACTCTACTCGAGTAGAGTCTTGTTCTTACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_025461.5-272s21c1
Sequence:CCGGGCTGTGACAATTAAGATTGATCTCGAGATCAATCTTAATTGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks