EMAIL THIS PAGE TO A FRIEND

COX17

COX17 cytochrome c oxidase copper chaperone

57 Gene Product Result for
UniProtKB ID: Q14061, B2R5D2, D3DN84, Q3MHD6
Gene ID:
Human(10063) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be involved in the recruitment of copper to mitochondria for incorporation into the COX apoenzyme. This protein shares 92% amino acid sequence identity with mouse and rat Cox17 proteins. This gene is no longer considered to be a candidate gene for COX deficiency. A pseudogene COX17P has been found on chromosome 13. [provided by RefSeq, Jul 2008]
Mouse(12856) cytochrome c oxidase assembly protein 17
Rat(89786) COX17 cytochrome c oxidase copper chaperone
Zebrafish(447914) COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)
cow(100295800) COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)
dog(503668) COX17 homolog, cytochrome c oxidase assembly protein (yeast)
chicken(770190) COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)
Thale Cress(820770) cytochrome c oxidase subunit XVII assembly protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005694 Rosetta Predictions human pricing
NM_053540 Rosetta Predictions rat pricing
NM_001017429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060024 predicted 245
2 SASI_Hs01_00060026 predicted 143
3 SASI_Hs01_00060027 predicted 220
4 SASI_Hs01_00060028 predicted 280
5 SASI_Hs02_00340096 predicted 343
6 SASI_Hs01_00060030 predicted 347
7 SASI_Hs02_00340097 predicted 185
8 SASI_Hs01_00060031 predicted 238
9 SASI_Hs01_00060032 predicted 242
10 SASI_Hs01_00060033 predicted 217
11 SASI_Hs01_00060025 predicted 283
12 SASI_Hs01_00060029 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063841 predicted 199
2 SASI_Rn01_00063842 predicted 128
3 SASI_Rn01_00063843 predicted 127
4 SASI_Rn01_00063844 predicted 126
5 SASI_Rn01_00063845 predicted 131
6 SASI_Rn02_00266161 predicted 166
7 SASI_Rn02_00266162 predicted 137
8 SASI_Rn01_00063846 predicted 132
9 SASI_Rn01_00063847 predicted 34
10 SASI_Rn01_00063848 predicted 126
11 SASI_Rn01_00063849 predicted 189
12 SASI_Rn01_00063850 predicted 81
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053377 predicted 203
2 SASI_Mm01_00053378 predicted 202
3 SASI_Mm01_00053379 predicted 199
4 SASI_Mm01_00053380 predicted 198
5 SASI_Mm01_00053381 predicted 199
6 SASI_Mm01_00053383 predicted 227
7 SASI_Mm01_00053384 predicted 188
8 SASI_Mm02_00287506 predicted 194
9 SASI_Mm01_00053386 predicted 301
10 SASI_Mm02_00287507 predicted 190
11 SASI_Mm01_00053382 predicted 365
12 SASI_Mm01_00053385 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017429
VALIDATED
COX17 MISSION shRNA Bacterial Glycerol Stock
COX17 cytochrome c oxidase copper chaperone
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-270s21c1
Sequence:CCGGGAGGGCACTGGGATTTAAGATCTCGAGATCTTAAATCCCAGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-229s21c1
Sequence:CCGGGAACACTGTGGACATCTCATTCTCGAGAATGAGATGTCCACAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-203s21c1
Sequence:CCGGATGCGTGCATCATTGAGAAAGCTCGAGCTTTCTCAATGATGCACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017429.2-302s21c1
Sequence:CCGGGCCTACTTTGTGAATGAATAACTCGAGTTATTCATTCACAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017429.1-232s1c1
Sequence:CCGGCACTGTGGACATCTCATTGAACTCGAGTTCAATGAGATGTCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017429.1-324s1c1
Sequence:CCGGCCTTGAAGAATGAAGAAGATTCTCGAGAATCTTCTTCATTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-270s1c1
Sequence:CCGGGAGGGCACTGGGATTTAAGATCTCGAGATCTTAAATCCCAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017429.1-205s1c1
Sequence:CCGGGCGTGCATCATTGAGAAAGGACTCGAGTCCTTTCTCAATGATGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-302s1c1
Sequence:CCGGGCCTACTTTGTGAATGAATAACTCGAGTTATTCATTCACAAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-229s1c1
Sequence:CCGGGAACACTGTGGACATCTCATTCTCGAGAATGAGATGTCCACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017429
VALIDATED
COX17 MISSION shRNA shRNA Plasmid DNA
COX17 cytochrome c oxidase copper chaperone
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-270s21c1
Sequence:CCGGGAGGGCACTGGGATTTAAGATCTCGAGATCTTAAATCCCAGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-229s21c1
Sequence:CCGGGAACACTGTGGACATCTCATTCTCGAGAATGAGATGTCCACAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-203s21c1
Sequence:CCGGATGCGTGCATCATTGAGAAAGCTCGAGCTTTCTCAATGATGCACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017429.2-302s21c1
Sequence:CCGGGCCTACTTTGTGAATGAATAACTCGAGTTATTCATTCACAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017429.1-232s1c1
Sequence:CCGGCACTGTGGACATCTCATTGAACTCGAGTTCAATGAGATGTCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017429.1-324s1c1
Sequence:CCGGCCTTGAAGAATGAAGAAGATTCTCGAGAATCTTCTTCATTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-270s1c1
Sequence:CCGGGAGGGCACTGGGATTTAAGATCTCGAGATCTTAAATCCCAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017429.1-205s1c1
Sequence:CCGGGCGTGCATCATTGAGAAAGGACTCGAGTCCTTTCTCAATGATGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-302s1c1
Sequence:CCGGGCCTACTTTGTGAATGAATAACTCGAGTTATTCATTCACAAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-229s1c1
Sequence:CCGGGAACACTGTGGACATCTCATTCTCGAGAATGAGATGTCCACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017429
VALIDATED
COX17 MISSION shRNA Lentiviral Transduction Particles
COX17 cytochrome c oxidase copper chaperone
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-270s21c1
Sequence:CCGGGAGGGCACTGGGATTTAAGATCTCGAGATCTTAAATCCCAGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-229s21c1
Sequence:CCGGGAACACTGTGGACATCTCATTCTCGAGAATGAGATGTCCACAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017429.2-203s21c1
Sequence:CCGGATGCGTGCATCATTGAGAAAGCTCGAGCTTTCTCAATGATGCACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017429.2-302s21c1
Sequence:CCGGGCCTACTTTGTGAATGAATAACTCGAGTTATTCATTCACAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017429.1-232s1c1
Sequence:CCGGCACTGTGGACATCTCATTGAACTCGAGTTCAATGAGATGTCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017429.1-324s1c1
Sequence:CCGGCCTTGAAGAATGAAGAAGATTCTCGAGAATCTTCTTCATTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-270s1c1
Sequence:CCGGGAGGGCACTGGGATTTAAGATCTCGAGATCTTAAATCCCAGTGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017429.1-205s1c1
Sequence:CCGGGCGTGCATCATTGAGAAAGGACTCGAGTCCTTTCTCAATGATGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-302s1c1
Sequence:CCGGGCCTACTTTGTGAATGAATAACTCGAGTTATTCATTCACAAAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001017429.1-229s1c1
Sequence:CCGGGAACACTGTGGACATCTCATTCTCGAGAATGAGATGTCCACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005694
COX17 MISSION shRNA Bacterial Glycerol Stock
COX17 cytochrome c oxidase copper chaperone
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-250s1c1
Sequence:CCGGGCATGAGAGCCCTAGGATTTACTCGAGTAAATCCTAGGGCTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-185s1c1
Sequence:CCGGCGATGCGTGTATCATCGAGAACTCGAGTTCTCGATGATACACGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-119s1c1
Sequence:CCGGGCCTGAGTCTCAGGAGAAGAACTCGAGTTCTTCTCCTGAGACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-189s1c1
Sequence:CCGGGCGTGTATCATCGAGAAAGGACTCGAGTCCTTTCTCGATGATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-224s1c1
Sequence:CCGGACATCTAATTGAGGCCCACAACTCGAGTTGTGGGCCTCAATTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005694
COX17 MISSION shRNA shRNA Plasmid DNA
COX17 cytochrome c oxidase copper chaperone
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-250s1c1
Sequence:CCGGGCATGAGAGCCCTAGGATTTACTCGAGTAAATCCTAGGGCTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-185s1c1
Sequence:CCGGCGATGCGTGTATCATCGAGAACTCGAGTTCTCGATGATACACGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-119s1c1
Sequence:CCGGGCCTGAGTCTCAGGAGAAGAACTCGAGTTCTTCTCCTGAGACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-189s1c1
Sequence:CCGGGCGTGTATCATCGAGAAAGGACTCGAGTCCTTTCTCGATGATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-224s1c1
Sequence:CCGGACATCTAATTGAGGCCCACAACTCGAGTTGTGGGCCTCAATTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005694
COX17 MISSION shRNA Lentiviral Transduction Particles
COX17 cytochrome c oxidase copper chaperone
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-250s1c1
Sequence:CCGGGCATGAGAGCCCTAGGATTTACTCGAGTAAATCCTAGGGCTCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-185s1c1
Sequence:CCGGCGATGCGTGTATCATCGAGAACTCGAGTTCTCGATGATACACGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-119s1c1
Sequence:CCGGGCCTGAGTCTCAGGAGAAGAACTCGAGTTCTTCTCCTGAGACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-189s1c1
Sequence:CCGGGCGTGTATCATCGAGAAAGGACTCGAGTCCTTTCTCGATGATACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005694.1-224s1c1
Sequence:CCGGACATCTAATTGAGGCCCACAACTCGAGTTGTGGGCCTCAATTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks