EMAIL THIS PAGE TO A FRIEND

COX18

COX18 cytochrome C oxidase assembly factor

86 Gene Product Result for
Synonyms: COX18HS
UniProtKB ID: Q8N8Q8, Q2PB66, Q2PB67, Q2PB68, Q49B97, Q6IPP9
Gene ID:
Human(285521) Summary: COX18 encodes a cytochrome c oxidase (COX)-assembly protein. The S. cerevisiae Cox18 protein catalyzes the insertion of the Cox2 (MTCO2; MIM 516040) C-terminal tail into the mitochondrial inner membrane, an intermediate step in the assembly of complex IV of the mitochondrial respiratory chain (Sacconi et al., 2005 [PubMed 16212937]
Mouse(231430) cytochrome c oxidase assembly protein 18
Rat(289522) cytochrome c oxidase assembly protein 18
chicken(422650) COX18 cytochrome c oxidase assembly homolog (S. cerevisiae)
cow(516925) COX18 cytochrome c oxidase assembly homolog (S. cerevisiae)
dog(482193) COX18 cytochrome c oxidase assembly homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173827 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035301 MISSION® esiRNA esiRNA human COX18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033760 Rosetta Predictions human pricing
NM_173827 Rosetta Predictions human pricing
NM_001106000 Rosetta Predictions rat pricing
NM_001033310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055562 predicted 824
2 SASI_Hs01_00055563 predicted 1009
3 SASI_Hs01_00055564 predicted 469
4 SASI_Hs01_00055565 predicted 1027
5 SASI_Hs01_00055566 predicted 889
6 SASI_Hs01_00055567 predicted 583
7 SASI_Hs01_00055568 predicted 642
8 SASI_Hs01_00055569 predicted 571
9 SASI_Hs01_00055570 predicted 488
10 SASI_Hs01_00055571 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066627 predicted 816
2 SASI_Hs01_00066628 predicted 1011
3 SASI_Hs01_00066629 predicted 465
4 SASI_Hs01_00066630 predicted 1015
5 SASI_Hs01_00066631 predicted 884
6 SASI_Hs01_00066632 predicted 576
7 SASI_Hs02_00368689 predicted 715
8 SASI_Hs01_00066633 predicted 636
9 SASI_Hs01_00066634 predicted 559
10 SASI_Hs01_00066635 predicted 479
11 SASI_Hs01_00066636 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214642 predicted 867
2 SASI_Rn02_00214643 predicted 260
3 SASI_Rn02_00214644 predicted 459
4 SASI_Rn02_00214645 predicted 435
5 SASI_Rn02_00214646 predicted 451
6 SASI_Rn02_00214647 predicted 414
7 SASI_Rn02_00214648 predicted 971
8 SASI_Rn02_00214649 predicted 691
9 SASI_Rn02_00214650 predicted 456
10 SASI_Rn02_00214651 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181127 predicted 994
2 SASI_Mm01_00181128 predicted 865
3 SASI_Mm01_00181129 predicted 798
4 SASI_Mm01_00181130 predicted 795
5 SASI_Mm01_00181131 predicted 1027
6 SASI_Mm01_00181132 predicted 412
7 SASI_Mm01_00181133 predicted 1052
8 SASI_Mm01_00181134 predicted 406
9 SASI_Mm01_00181135 predicted 371
10 SASI_Mm01_00181136 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033310
VALIDATED
COX18 MISSION shRNA Bacterial Glycerol Stock
COX18 cytochrome C oxidase assembly factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-995s1c1
Sequence:CCGGCGCCAAGTTCCTTTCAAGAAACTCGAGTTTCTTGAAAGGAACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-1076s1c1
Sequence:CCGGGCATTGAATTTGGAAGTCTATCTCGAGATAGACTTCCAAATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033310.1-601s1c1
Sequence:CCGGCCACACATTCAGACGGCATTTCTCGAGAAATGCCGTCTGAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-721s1c1
Sequence:CCGGACCTACTGATAGTGGAGATTTCTCGAGAAATCTCCACTATCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-462s1c1
Sequence:CCGGCTGAAGAACATGCGGAGACTTCTCGAGAAGTCTCCGCATGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033310
VALIDATED
COX18 MISSION shRNA shRNA Plasmid DNA
COX18 cytochrome C oxidase assembly factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-995s1c1
Sequence:CCGGCGCCAAGTTCCTTTCAAGAAACTCGAGTTTCTTGAAAGGAACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-1076s1c1
Sequence:CCGGGCATTGAATTTGGAAGTCTATCTCGAGATAGACTTCCAAATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033310.1-601s1c1
Sequence:CCGGCCACACATTCAGACGGCATTTCTCGAGAAATGCCGTCTGAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-721s1c1
Sequence:CCGGACCTACTGATAGTGGAGATTTCTCGAGAAATCTCCACTATCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-462s1c1
Sequence:CCGGCTGAAGAACATGCGGAGACTTCTCGAGAAGTCTCCGCATGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033310
VALIDATED
COX18 MISSION shRNA Lentiviral Transduction Particles
COX18 cytochrome C oxidase assembly factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-995s1c1
Sequence:CCGGCGCCAAGTTCCTTTCAAGAAACTCGAGTTTCTTGAAAGGAACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-1076s1c1
Sequence:CCGGGCATTGAATTTGGAAGTCTATCTCGAGATAGACTTCCAAATTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033310.1-601s1c1
Sequence:CCGGCCACACATTCAGACGGCATTTCTCGAGAAATGCCGTCTGAATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-721s1c1
Sequence:CCGGACCTACTGATAGTGGAGATTTCTCGAGAAATCTCCACTATCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033310.1-462s1c1
Sequence:CCGGCTGAAGAACATGCGGAGACTTCTCGAGAAGTCTCCGCATGTTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173827
VALIDATED
COX18 MISSION shRNA Bacterial Glycerol Stock
COX18 cytochrome C oxidase assembly factor
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-433s1c1
Sequence:CCGGGCCAGGCATCTTAACCAAGAACTCGAGTTCTTGGTTAAGATGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-959s1c1
Sequence:CCGGCTCCTGGATTTCGCCAACTTTCTCGAGAAAGTTGGCGAAATCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-2648s1c1
Sequence:CCGGCCTGCTCAGAAAGAATACAAACTCGAGTTTGTATTCTTTCTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-1561s1c1
Sequence:CCGGGCAGTATGTTTGTGAAAGTATCTCGAGATACTTTCACAAACATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-2759s1c1
Sequence:CCGGGCATTCAGATTGTTTAGTCAACTCGAGTTGACTAAACAATCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-602s1c1
Sequence:CCGGCAATGTGGATCTTCATGTCTTCTCGAGAAGACATGAAGATCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173827.1-442s1c1
Sequence:CCGGCTTAACCAAGAAGTTGCAGTTCTCGAGAACTGCAACTTCTTGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173827.1-536s1c1
Sequence:CCGGCAGAGCTATATGTGCGAGATACTCGAGTATCTCGCACATATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-992s1c1
Sequence:CCGGCGACCAAGTCAGATTCAGAAACTCGAGTTTCTGAATCTGACTTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-577s21c1
Sequence:CCGGAGAGCTATATGTGCGAGATAACTCGAGTTATCTCGCACATATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-864s21c1
Sequence:CCGGAGACGTATATTACGTACTTTGCTCGAGCAAAGTACGTAATATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-1007s21c1
Sequence:CCGGTTTCGCCAACTTTGCCGAATACTCGAGTATTCGGCAAAGTTGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173827.2-2883s21c1
Sequence:CCGGAGTACCCTAATAGGCTTAAACCTCGAGGTTTAAGCCTATTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-896s21c1
Sequence:CCGGTCGGTGTTGATGATACCAATTCTCGAGAATTGGTATCATCAACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173827
VALIDATED
COX18 MISSION shRNA shRNA Plasmid DNA
COX18 cytochrome C oxidase assembly factor
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-433s1c1
Sequence:CCGGGCCAGGCATCTTAACCAAGAACTCGAGTTCTTGGTTAAGATGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-959s1c1
Sequence:CCGGCTCCTGGATTTCGCCAACTTTCTCGAGAAAGTTGGCGAAATCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-2648s1c1
Sequence:CCGGCCTGCTCAGAAAGAATACAAACTCGAGTTTGTATTCTTTCTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-1561s1c1
Sequence:CCGGGCAGTATGTTTGTGAAAGTATCTCGAGATACTTTCACAAACATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-2759s1c1
Sequence:CCGGGCATTCAGATTGTTTAGTCAACTCGAGTTGACTAAACAATCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-602s1c1
Sequence:CCGGCAATGTGGATCTTCATGTCTTCTCGAGAAGACATGAAGATCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173827.1-442s1c1
Sequence:CCGGCTTAACCAAGAAGTTGCAGTTCTCGAGAACTGCAACTTCTTGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173827.1-536s1c1
Sequence:CCGGCAGAGCTATATGTGCGAGATACTCGAGTATCTCGCACATATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-992s1c1
Sequence:CCGGCGACCAAGTCAGATTCAGAAACTCGAGTTTCTGAATCTGACTTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-577s21c1
Sequence:CCGGAGAGCTATATGTGCGAGATAACTCGAGTTATCTCGCACATATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-864s21c1
Sequence:CCGGAGACGTATATTACGTACTTTGCTCGAGCAAAGTACGTAATATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-1007s21c1
Sequence:CCGGTTTCGCCAACTTTGCCGAATACTCGAGTATTCGGCAAAGTTGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173827.2-2883s21c1
Sequence:CCGGAGTACCCTAATAGGCTTAAACCTCGAGGTTTAAGCCTATTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-896s21c1
Sequence:CCGGTCGGTGTTGATGATACCAATTCTCGAGAATTGGTATCATCAACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173827
VALIDATED
COX18 MISSION shRNA Lentiviral Transduction Particles
COX18 cytochrome C oxidase assembly factor
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-433s1c1
Sequence:CCGGGCCAGGCATCTTAACCAAGAACTCGAGTTCTTGGTTAAGATGCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-959s1c1
Sequence:CCGGCTCCTGGATTTCGCCAACTTTCTCGAGAAAGTTGGCGAAATCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-2648s1c1
Sequence:CCGGCCTGCTCAGAAAGAATACAAACTCGAGTTTGTATTCTTTCTGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-1561s1c1
Sequence:CCGGGCAGTATGTTTGTGAAAGTATCTCGAGATACTTTCACAAACATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173827.1-2759s1c1
Sequence:CCGGGCATTCAGATTGTTTAGTCAACTCGAGTTGACTAAACAATCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-602s1c1
Sequence:CCGGCAATGTGGATCTTCATGTCTTCTCGAGAAGACATGAAGATCCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173827.1-442s1c1
Sequence:CCGGCTTAACCAAGAAGTTGCAGTTCTCGAGAACTGCAACTTCTTGGTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173827.1-536s1c1
Sequence:CCGGCAGAGCTATATGTGCGAGATACTCGAGTATCTCGCACATATAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_173827.1-992s1c1
Sequence:CCGGCGACCAAGTCAGATTCAGAAACTCGAGTTTCTGAATCTGACTTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-577s21c1
Sequence:CCGGAGAGCTATATGTGCGAGATAACTCGAGTTATCTCGCACATATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-864s21c1
Sequence:CCGGAGACGTATATTACGTACTTTGCTCGAGCAAAGTACGTAATATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-1007s21c1
Sequence:CCGGTTTCGCCAACTTTGCCGAATACTCGAGTATTCGGCAAAGTTGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173827.2-2883s21c1
Sequence:CCGGAGTACCCTAATAGGCTTAAACCTCGAGGTTTAAGCCTATTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173827.2-896s21c1
Sequence:CCGGTCGGTGTTGATGATACCAATTCTCGAGAATTGGTATCATCAACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks