EMAIL THIS PAGE TO A FRIEND

COX19

cytochrome c oxidase assembly homolog 19 (S. cerevisiae)

50 Gene Product Result for
UniProtKB ID: Q49B96, A4FTX0
Gene ID:
Human(90639) Summary: COX19 encodes a cytochrome c oxidase (COX)-assembly protein. The S. cerevisiae Cox19 protein may play a role in metal transport to the mitochondrial intermembrane space and assembly of complex IV of the mitochondrial respiratory chain (Sacconi et al., 2005 [PubMed 16212937]
Mouse(68033) cytochrome c oxidase assembly protein 19
Rat(304330) cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
chicken(416452) COX19 cytochrome c oxidase assembly homolog (S. cerevisiae)
dog(100685945) COX19 cytochrome c oxidase assembly homolog (S. cerevisiae)
cow(100126182) COX19 cytochrome c oxidase assembly homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197980 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197980 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197980 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001031617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031617 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031617 Rosetta Predictions human pricing
NM_001107126 Rosetta Predictions rat pricing
NM_197980 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215387 predicted 313
2 SASI_Hs01_00215388 predicted 291
3 SASI_Hs01_00215390 predicted 312
4 SASI_Hs01_00215389 predicted 313
5 SASI_Hs01_00215391 predicted 532
6 SASI_Hs01_00215392 predicted 97
7 SASI_Hs01_00215394 predicted 612
8 SASI_Hs01_00215395 predicted 751
9 SASI_Hs02_00307654 predicted 698
10 SASI_Hs02_00307655 predicted 321
11 SASI_Hs01_00215393 predicted 111
12 SASI_Hs01_00215396 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107126 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225756 predicted 212
2 SASI_Rn02_00225757 predicted 330
3 SASI_Rn02_00225758 predicted 204
4 SASI_Rn02_00225759 predicted 320
5 SASI_Rn02_00225760 predicted 457
6 SASI_Rn02_00225761 predicted 669
7 SASI_Rn02_00225762 predicted 765
8 SASI_Rn02_00225763 predicted 569
9 SASI_Rn02_00225764 predicted 219
10 SASI_Rn02_00225765 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197980 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055634 predicted 438
2 SASI_Mm01_00055635 predicted 519
3 SASI_Mm01_00055636 predicted 398
4 SASI_Mm01_00055637 predicted 241
5 SASI_Mm01_00055638 predicted 234
6 SASI_Mm01_00055639 predicted 438
7 SASI_Mm01_00055640 predicted 220
8 SASI_Mm02_00350666 predicted 505
9 SASI_Mm01_00055641 predicted 266
10 SASI_Mm01_00055642 predicted 517
11 SASI_Mm01_00055633 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197980
VALIDATED
COX19 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197980.1-238s21c1
Sequence:CCGGGCTCGGCTTTAGAGACCTAATCTCGAGATTAGGTCTCTAAAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-132s21c1
Sequence:CCGGGTCTCCGTGACAAGAACTATGCTCGAGCATAGTTCTTGTCACGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-268s21c1
Sequence:CCGGGCCAGAGGCAAAGGATGAATGCTCGAGCATTCATCCTTTGCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-431s21c1
Sequence:CCGGTGCAGCACACACCGAAATGTTCTCGAGAACATTTCGGTGTGTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-165s21c1
Sequence:CCGGGCAGAAATGAATCTAAAGAGTCTCGAGACTCTTTAGATTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-165s1c1
Sequence:CCGGGCAGAAATGAATCTAAAGAGTCTCGAGACTCTTTAGATTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197980.1-270s1c1
Sequence:CCGGCAGAGGCAAAGGATGAATGTTCTCGAGAACATTCATCCTTTGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-238s1c1
Sequence:CCGGGCTCGGCTTTAGAGACCTAATCTCGAGATTAGGTCTCTAAAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-626s1c1
Sequence:CCGGCTCACACTGGAACCTGTCAATCTCGAGATTGACAGGTTCCAGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197980.1-243s1c1
Sequence:CCGGGCTTTAGAGACCTAATGGAAGCTCGAGCTTCCATTAGGTCTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197980
VALIDATED
COX19 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197980.1-238s21c1
Sequence:CCGGGCTCGGCTTTAGAGACCTAATCTCGAGATTAGGTCTCTAAAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-132s21c1
Sequence:CCGGGTCTCCGTGACAAGAACTATGCTCGAGCATAGTTCTTGTCACGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-268s21c1
Sequence:CCGGGCCAGAGGCAAAGGATGAATGCTCGAGCATTCATCCTTTGCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-431s21c1
Sequence:CCGGTGCAGCACACACCGAAATGTTCTCGAGAACATTTCGGTGTGTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-165s21c1
Sequence:CCGGGCAGAAATGAATCTAAAGAGTCTCGAGACTCTTTAGATTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-165s1c1
Sequence:CCGGGCAGAAATGAATCTAAAGAGTCTCGAGACTCTTTAGATTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197980.1-270s1c1
Sequence:CCGGCAGAGGCAAAGGATGAATGTTCTCGAGAACATTCATCCTTTGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-238s1c1
Sequence:CCGGGCTCGGCTTTAGAGACCTAATCTCGAGATTAGGTCTCTAAAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-626s1c1
Sequence:CCGGCTCACACTGGAACCTGTCAATCTCGAGATTGACAGGTTCCAGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197980.1-243s1c1
Sequence:CCGGGCTTTAGAGACCTAATGGAAGCTCGAGCTTCCATTAGGTCTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197980
VALIDATED
COX19 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197980.1-238s21c1
Sequence:CCGGGCTCGGCTTTAGAGACCTAATCTCGAGATTAGGTCTCTAAAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-132s21c1
Sequence:CCGGGTCTCCGTGACAAGAACTATGCTCGAGCATAGTTCTTGTCACGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-268s21c1
Sequence:CCGGGCCAGAGGCAAAGGATGAATGCTCGAGCATTCATCCTTTGCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-431s21c1
Sequence:CCGGTGCAGCACACACCGAAATGTTCTCGAGAACATTTCGGTGTGTGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_197980.1-165s21c1
Sequence:CCGGGCAGAAATGAATCTAAAGAGTCTCGAGACTCTTTAGATTCATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-165s1c1
Sequence:CCGGGCAGAAATGAATCTAAAGAGTCTCGAGACTCTTTAGATTCATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197980.1-270s1c1
Sequence:CCGGCAGAGGCAAAGGATGAATGTTCTCGAGAACATTCATCCTTTGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-238s1c1
Sequence:CCGGGCTCGGCTTTAGAGACCTAATCTCGAGATTAGGTCTCTAAAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_197980.1-626s1c1
Sequence:CCGGCTCACACTGGAACCTGTCAATCTCGAGATTGACAGGTTCCAGTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197980.1-243s1c1
Sequence:CCGGGCTTTAGAGACCTAATGGAAGCTCGAGCTTCCATTAGGTCTCTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031617
COX19 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-289s21c1
Sequence:GTACCGGTTGATGCTACAAGAACCATTGCTCGAGCAATGGTTCTTGTAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031617.2-1690s21c1
Sequence:CCGGTGAGTGCTGCAGACGTATTAACTCGAGTTAATACGTCTGCAGCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-237s21c1
Sequence:CCGGTTTGTGCAGAAAGGAATCAAACTCGAGTTTGATTCCTTTCTGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-203s21c1
Sequence:CCGGTGAAGTGTCTTCATAACAATACTCGAGTATTGTTATGAAGACACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-159s21c1
Sequence:CCGGGCTGGATCACTTAGGTGAATGCTCGAGCATTCACCTAAGTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-1653s1c1
Sequence:CCGGCGTATTAACATATCACCGCTACTCGAGTAGCGGTGATATGTTAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-1669s1c1
Sequence:CCGGCGCTAGTTGATGGAAAGTCTTCTCGAGAAGACTTTCCATCAACTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031617.1-108s1c1
Sequence:CCGGCGCTGGATCACTTAGGTGAATCTCGAGATTCACCTAAGTGATCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-743s1c1
Sequence:CCGGGCCAGTTCATTTCCTTTGAAACTCGAGTTTCAAAGGAAATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031617
COX19 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-289s21c1
Sequence:GTACCGGTTGATGCTACAAGAACCATTGCTCGAGCAATGGTTCTTGTAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031617.2-1690s21c1
Sequence:CCGGTGAGTGCTGCAGACGTATTAACTCGAGTTAATACGTCTGCAGCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-237s21c1
Sequence:CCGGTTTGTGCAGAAAGGAATCAAACTCGAGTTTGATTCCTTTCTGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-203s21c1
Sequence:CCGGTGAAGTGTCTTCATAACAATACTCGAGTATTGTTATGAAGACACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-159s21c1
Sequence:CCGGGCTGGATCACTTAGGTGAATGCTCGAGCATTCACCTAAGTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-1653s1c1
Sequence:CCGGCGTATTAACATATCACCGCTACTCGAGTAGCGGTGATATGTTAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-1669s1c1
Sequence:CCGGCGCTAGTTGATGGAAAGTCTTCTCGAGAAGACTTTCCATCAACTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031617.1-108s1c1
Sequence:CCGGCGCTGGATCACTTAGGTGAATCTCGAGATTCACCTAAGTGATCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-743s1c1
Sequence:CCGGGCCAGTTCATTTCCTTTGAAACTCGAGTTTCAAAGGAAATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031617
COX19 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase assembly homolog 19 (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-289s21c1
Sequence:GTACCGGTTGATGCTACAAGAACCATTGCTCGAGCAATGGTTCTTGTAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031617.2-1690s21c1
Sequence:CCGGTGAGTGCTGCAGACGTATTAACTCGAGTTAATACGTCTGCAGCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-237s21c1
Sequence:CCGGTTTGTGCAGAAAGGAATCAAACTCGAGTTTGATTCCTTTCTGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-203s21c1
Sequence:CCGGTGAAGTGTCTTCATAACAATACTCGAGTATTGTTATGAAGACACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031617.2-159s21c1
Sequence:CCGGGCTGGATCACTTAGGTGAATGCTCGAGCATTCACCTAAGTGATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-1653s1c1
Sequence:CCGGCGTATTAACATATCACCGCTACTCGAGTAGCGGTGATATGTTAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-1669s1c1
Sequence:CCGGCGCTAGTTGATGGAAAGTCTTCTCGAGAAGACTTTCCATCAACTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031617.1-108s1c1
Sequence:CCGGCGCTGGATCACTTAGGTGAATCTCGAGATTCACCTAAGTGATCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183296    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031617.1-743s1c1
Sequence:CCGGGCCAGTTCATTTCCTTTGAAACTCGAGTTTCAAAGGAAATGAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks