EMAIL THIS PAGE TO A FRIEND

COX20

COX20 cytochrome C oxidase assembly factor

47 Gene Product Result for
Synonyms: FAM36A
UniProtKB ID: Q5RI15, Q8WV86
Gene ID:
Mouse(66359) COX20 Cox2 chaperone
Rat(289278) COX20 cytochrome C oxidase assembly factor
sheep(101117005) COX20 Cox2 chaperone homolog (S. cerevisiae)
chicken(421493) COX20 Cox2 chaperone homolog (S. cerevisiae)
cow(615660) COX20 Cox2 chaperone homolog (S. cerevisiae)
dog(480099) COX20 Cox2 chaperone homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025511 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025511 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025511 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198076 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198076 Rosetta Predictions human pricing
NM_001105976 Rosetta Predictions rat pricing
NM_025511 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099291 predicted 1014
2 SASI_Hs02_00371626 predicted 1016
3 SASI_Hs01_00099296 predicted 1016
4 SASI_Hs01_00099292 predicted 572
5 SASI_Hs01_00099293 predicted 732
6 SASI_Hs01_00099294 predicted 761
7 SASI_Hs01_00099295 predicted 911
8 SASI_Hs01_00099297 predicted 797
9 SASI_Hs01_00099298 predicted 850
10 SASI_Hs01_00099299 predicted 997
11 SASI_Hs01_00099300 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214402 predicted 629
2 SASI_Rn02_00214403 predicted 608
3 SASI_Rn02_00214404 predicted 433
4 SASI_Rn02_00214405 predicted 783
5 SASI_Rn02_00214406 predicted 662
6 SASI_Rn02_00214407 predicted 787
7 SASI_Rn02_00214408 predicted 393
8 SASI_Rn02_00214409 predicted 636
9 SASI_Rn02_00214410 predicted 734
10 SASI_Rn02_00214411 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025511 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079514 predicted 202
2 SASI_Mm01_00079515 predicted 202
3 SASI_Mm01_00079516 predicted 213
4 SASI_Mm01_00079517 predicted 201
5 SASI_Mm01_00079518 predicted 198
6 SASI_Mm01_00079519 predicted 223
7 SASI_Mm01_00079520 predicted 204
8 SASI_Mm01_00079521 predicted 223
9 SASI_Mm01_00079523 predicted 232
10 SASI_Mm02_00328399 predicted 245
11 SASI_Mm01_00079522 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025511
VALIDATED
COX20 MISSION shRNA Bacterial Glycerol Stock
COX20 cytochrome C oxidase assembly factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-267s1c1
Sequence:CCGGCAGGAAAGAATTGCCAGAGAACTCGAGTTCTCTGGCAATTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-137s1c1
Sequence:CCGGGACTGGACTTGGACATTTCTTCTCGAGAAGAAATGTCCAAGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025511.1-163s1c1
Sequence:CCGGCCAGTAGAATTAGAAGATCATCTCGAGATGATCTTCTAATTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-266s1c1
Sequence:CCGGCCAGGAAAGAATTGCCAGAGACTCGAGTCTCTGGCAATTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-274s1c1
Sequence:CCGGGAATTGCCAGAGAAGGAATAACTCGAGTTATTCCTTCTCTGGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-169s21c1
Sequence:CCGGCCAGTAGAATTAGAAGATCATCTCGAGATGATCTTCTAATTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-280s21c1
Sequence:CCGGGAATTGCCAGAGAAGGAATAACTCGAGTTATTCCTTCTCTGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-143s21c1
Sequence:CCGGGACTGGACTTGGACATTTCTTCTCGAGAAGAAATGTCCAAGTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-272s21c1
Sequence:CCGGCCAGGAAAGAATTGCCAGAGACTCGAGTCTCTGGCAATTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025511
VALIDATED
COX20 MISSION shRNA shRNA Plasmid DNA
COX20 cytochrome C oxidase assembly factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-267s1c1
Sequence:CCGGCAGGAAAGAATTGCCAGAGAACTCGAGTTCTCTGGCAATTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-137s1c1
Sequence:CCGGGACTGGACTTGGACATTTCTTCTCGAGAAGAAATGTCCAAGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025511.1-163s1c1
Sequence:CCGGCCAGTAGAATTAGAAGATCATCTCGAGATGATCTTCTAATTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-266s1c1
Sequence:CCGGCCAGGAAAGAATTGCCAGAGACTCGAGTCTCTGGCAATTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-274s1c1
Sequence:CCGGGAATTGCCAGAGAAGGAATAACTCGAGTTATTCCTTCTCTGGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-169s21c1
Sequence:CCGGCCAGTAGAATTAGAAGATCATCTCGAGATGATCTTCTAATTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-280s21c1
Sequence:CCGGGAATTGCCAGAGAAGGAATAACTCGAGTTATTCCTTCTCTGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-143s21c1
Sequence:CCGGGACTGGACTTGGACATTTCTTCTCGAGAAGAAATGTCCAAGTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-272s21c1
Sequence:CCGGCCAGGAAAGAATTGCCAGAGACTCGAGTCTCTGGCAATTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025511
VALIDATED
COX20 MISSION shRNA Lentiviral Transduction Particles
COX20 cytochrome C oxidase assembly factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-267s1c1
Sequence:CCGGCAGGAAAGAATTGCCAGAGAACTCGAGTTCTCTGGCAATTCTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-137s1c1
Sequence:CCGGGACTGGACTTGGACATTTCTTCTCGAGAAGAAATGTCCAAGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025511.1-163s1c1
Sequence:CCGGCCAGTAGAATTAGAAGATCATCTCGAGATGATCTTCTAATTCTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-266s1c1
Sequence:CCGGCCAGGAAAGAATTGCCAGAGACTCGAGTCTCTGGCAATTCTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025511.1-274s1c1
Sequence:CCGGGAATTGCCAGAGAAGGAATAACTCGAGTTATTCCTTCTCTGGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-169s21c1
Sequence:CCGGCCAGTAGAATTAGAAGATCATCTCGAGATGATCTTCTAATTCTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-280s21c1
Sequence:CCGGGAATTGCCAGAGAAGGAATAACTCGAGTTATTCCTTCTCTGGCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-143s21c1
Sequence:CCGGGACTGGACTTGGACATTTCTTCTCGAGAAGAAATGTCCAAGTCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025511.2-272s21c1
Sequence:CCGGCCAGGAAAGAATTGCCAGAGACTCGAGTCTCTGGCAATTCTTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198076
VALIDATED
COX20 MISSION shRNA Bacterial Glycerol Stock
COX20 cytochrome C oxidase assembly factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198076.2-299s1c1
Sequence:CCGGCAAAGCAAAGAATCCAGGAAACTCGAGTTTCCTGGATTCTTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198076.2-263s1c1
Sequence:CCGGCTTTGGGATGCTGGTTTCATTCTCGAGAATGAAACCAGCATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198076.4-476s21c1
Sequence:CCGGCAATATTGTATGGTTCATTAGCTCGAGCTAATGAACCATACAATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198076.4-599s21c1
Sequence:CCGGGGTTTCATTGTAGGTATAATTCTCGAGAATTATACCTACAATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198076.4-1665s21c1
Sequence:CCGGGCCATTACTGGTCCTATTATTCTCGAGAATAATAGGACCAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_198076.4-558s21c1
Sequence:CCGGTGTTGGAGTAGGAGGGTTTATCTCGAGATAAACCCTCCTACTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_198076.4-725s21c1
Sequence:GTACCGGGCAGCAATTGAACAATCTTGACTCGAGTCAAGATTGTTCAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198076
VALIDATED
COX20 MISSION shRNA shRNA Plasmid DNA
COX20 cytochrome C oxidase assembly factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198076.2-299s1c1
Sequence:CCGGCAAAGCAAAGAATCCAGGAAACTCGAGTTTCCTGGATTCTTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198076.2-263s1c1
Sequence:CCGGCTTTGGGATGCTGGTTTCATTCTCGAGAATGAAACCAGCATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198076.4-476s21c1
Sequence:CCGGCAATATTGTATGGTTCATTAGCTCGAGCTAATGAACCATACAATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198076.4-599s21c1
Sequence:CCGGGGTTTCATTGTAGGTATAATTCTCGAGAATTATACCTACAATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198076.4-1665s21c1
Sequence:CCGGGCCATTACTGGTCCTATTATTCTCGAGAATAATAGGACCAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_198076.4-558s21c1
Sequence:CCGGTGTTGGAGTAGGAGGGTTTATCTCGAGATAAACCCTCCTACTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_198076.4-725s21c1
Sequence:GTACCGGGCAGCAATTGAACAATCTTGACTCGAGTCAAGATTGTTCAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198076
VALIDATED
COX20 MISSION shRNA Lentiviral Transduction Particles
COX20 cytochrome C oxidase assembly factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198076.2-299s1c1
Sequence:CCGGCAAAGCAAAGAATCCAGGAAACTCGAGTTTCCTGGATTCTTTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198076.2-263s1c1
Sequence:CCGGCTTTGGGATGCTGGTTTCATTCTCGAGAATGAAACCAGCATCCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198076.4-476s21c1
Sequence:CCGGCAATATTGTATGGTTCATTAGCTCGAGCTAATGAACCATACAATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198076.4-599s21c1
Sequence:CCGGGGTTTCATTGTAGGTATAATTCTCGAGAATTATACCTACAATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198076.4-1665s21c1
Sequence:CCGGGCCATTACTGGTCCTATTATTCTCGAGAATAATAGGACCAGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_198076.4-558s21c1
Sequence:CCGGTGTTGGAGTAGGAGGGTTTATCTCGAGATAAACCCTCCTACTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_198076.4-725s21c1
Sequence:GTACCGGGCAGCAATTGAACAATCTTGACTCGAGTCAAGATTGTTCAATTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks