EMAIL THIS PAGE TO A FRIEND

COX4I1

cytochrome c oxidase subunit IV isoform 1

79 Gene Product Result for
Synonyms: COX4 COX4-1 COXIV
UniProtKB ID: P13073, B2R4J2, D3DUM7, Q6P666
Gene ID:
Human(1327) Summary: Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit IV isoform 1 of the human mitochondrial respiratory chain enzyme. It is located at the 3' of the NOC4 (neighbor of COX4) gene in a head-to-head orientation, and shares a promoter with it. [provided by RefSeq, Jul 2008]
Mouse(12857) cytochrome c oxidase subunit IV isoform 1
Rat(29445) cytochrome c oxidase subunit IV isoform 1
Domestic Rabbit(100327269) cytochrome c oxidase subunit IV isoform 1
Zebrafish(326975) cytochrome c oxidase subunit IV isoform 1
dog(479623) cytochrome c oxidase subunit IV isoform 1
chicken(415826) cytochrome c oxidase subunit IV isoform 1
cow(281090) cytochrome c oxidase subunit IV isoform 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500412 Anti-COX41, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB2500268 Anti-COX4I1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405644 Anti-COX4I1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2701802 Anti-cox4i1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2108015 Anti-COX4I1 antibody produced in rabbit IgG fraction of antiserum human, bovine, rabbit, canine, mouse, rabbit, horse, guinea pig
immunohistochemistry, western blot pricing
HPA002485 Anti-COX4I1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5300321 Monoclonal Anti-COX4I1 antibody produced in mouse clone 6B3, ascites fluid rat, human, monkey, mouse
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB1402152 Monoclonal Anti-COX4I1 antibody produced in mouse clone 4A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB91171 Monoclonal Anti-COX4I1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3497, purified immunoglobulin, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
AMAB91173 Monoclonal Anti-COX4I1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3501, purified immunoglobulin, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing
AMAB91176 Monoclonal Anti-COX4I1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3515, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001861 Rosetta Predictions human pricing
NM_017202 Rosetta Predictions rat pricing
NM_009941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160871 predicted 219
2 SASI_Hs01_00160873 predicted 417
3 SASI_Hs02_00332690 predicted 212
4 SASI_Hs01_00160874 predicted 396
5 SASI_Hs01_00160877 predicted 378
6 SASI_Hs02_00332691 predicted 395
7 SASI_Hs02_00332692 predicted 401
8 SASI_Hs02_00332693 predicted 200
9 SASI_Hs02_00332694 predicted 374
10 SASI_Hs01_00160868 predicted 476
11 SASI_Hs01_00160869 predicted 515
12 SASI_Hs01_00160870 predicted 485
13 SASI_Hs01_00160872 predicted 496
14 SASI_Hs01_00160875 predicted 207
15 SASI_Hs01_00160876 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109976 predicted 402
2 SASI_Rn02_00261559 predicted 342
3 SASI_Rn01_00109977 predicted 425
4 SASI_Rn02_00261560 predicted 352
5 SASI_Rn02_00261561 predicted 312
6 SASI_Rn01_00109978 predicted 425
7 SASI_Rn02_00261562 predicted 228
8 SASI_Rn01_00109979 predicted 417
9 SASI_Rn01_00109980 predicted 400
10 SASI_Rn02_00261563 predicted 327
11 SASI_Rn01_00109981 predicted 375
12 SASI_Rn01_00109982 predicted 446
13 SASI_Rn01_00109983 predicted 380
14 SASI_Rn01_00109984 predicted 377
15 SASI_Rn01_00109985 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083075 predicted 319
2 SASI_Mm01_00083076 predicted 348
3 SASI_Mm01_00083077 predicted 305
4 SASI_Mm01_00083078 predicted 406
5 SASI_Mm01_00083079 predicted 451
6 SASI_Mm01_00083080 predicted 295
7 SASI_Mm01_00083081 predicted 289
8 SASI_Mm01_00083082 predicted 392
9 SASI_Mm01_00083083 predicted 352
10 SASI_Mm01_00083084 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009941
VALIDATED
COX4I1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit IV isoform 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-412s21c1
Sequence:CCGGGCTCGTTCTGATTTGGGAGAACTCGAGTTCTCCCAAATCAGAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-449s21c1
Sequence:CCGGCCCATCCCTCATACTTTCGATCTCGAGATCGAAAGTATGAGGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-289s21c1
Sequence:CCGGCAGGGATGAGAAAGTTCAGTTCTCGAGAACTGAACTTTCTCATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-316s21c1
Sequence:CCGGCATCCAGTTTAACGAGAGCTTCTCGAGAAGCTCTCGTTAAACTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-402s1c1
Sequence:CCGGGCTCGTTCTGATTTGGGAGAACTCGAGTTCTCCCAAATCAGAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-439s1c1
Sequence:CCGGCCCATCCCTCATACTTTCGATCTCGAGATCGAAAGTATGAGGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009941.1-99s1c1
Sequence:CCGGCATTTCTACTTCGGTGTGCCTCTCGAGAGGCACACCGAAGTAGAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-306s1c1
Sequence:CCGGCATCCAGTTTAACGAGAGCTTCTCGAGAAGCTCTCGTTAAACTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-279s1c1
Sequence:CCGGCAGGGATGAGAAAGTTCAGTTCTCGAGAACTGAACTTTCTCATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009941
VALIDATED
COX4I1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit IV isoform 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-412s21c1
Sequence:CCGGGCTCGTTCTGATTTGGGAGAACTCGAGTTCTCCCAAATCAGAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-449s21c1
Sequence:CCGGCCCATCCCTCATACTTTCGATCTCGAGATCGAAAGTATGAGGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-289s21c1
Sequence:CCGGCAGGGATGAGAAAGTTCAGTTCTCGAGAACTGAACTTTCTCATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-316s21c1
Sequence:CCGGCATCCAGTTTAACGAGAGCTTCTCGAGAAGCTCTCGTTAAACTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-402s1c1
Sequence:CCGGGCTCGTTCTGATTTGGGAGAACTCGAGTTCTCCCAAATCAGAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-439s1c1
Sequence:CCGGCCCATCCCTCATACTTTCGATCTCGAGATCGAAAGTATGAGGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009941.1-99s1c1
Sequence:CCGGCATTTCTACTTCGGTGTGCCTCTCGAGAGGCACACCGAAGTAGAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-306s1c1
Sequence:CCGGCATCCAGTTTAACGAGAGCTTCTCGAGAAGCTCTCGTTAAACTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-279s1c1
Sequence:CCGGCAGGGATGAGAAAGTTCAGTTCTCGAGAACTGAACTTTCTCATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009941
VALIDATED
COX4I1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit IV isoform 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-412s21c1
Sequence:CCGGGCTCGTTCTGATTTGGGAGAACTCGAGTTCTCCCAAATCAGAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-449s21c1
Sequence:CCGGCCCATCCCTCATACTTTCGATCTCGAGATCGAAAGTATGAGGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-289s21c1
Sequence:CCGGCAGGGATGAGAAAGTTCAGTTCTCGAGAACTGAACTTTCTCATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009941.2-316s21c1
Sequence:CCGGCATCCAGTTTAACGAGAGCTTCTCGAGAAGCTCTCGTTAAACTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-402s1c1
Sequence:CCGGGCTCGTTCTGATTTGGGAGAACTCGAGTTCTCCCAAATCAGAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-439s1c1
Sequence:CCGGCCCATCCCTCATACTTTCGATCTCGAGATCGAAAGTATGAGGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009941.1-99s1c1
Sequence:CCGGCATTTCTACTTCGGTGTGCCTCTCGAGAGGCACACCGAAGTAGAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-306s1c1
Sequence:CCGGCATCCAGTTTAACGAGAGCTTCTCGAGAAGCTCTCGTTAAACTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009941.1-279s1c1
Sequence:CCGGCAGGGATGAGAAAGTTCAGTTCTCGAGAACTGAACTTTCTCATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001861
VALIDATED
COX4I1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit IV isoform 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-190s21c1
Sequence:CCGGTAGTTGGCAAGCGAGCAATTTCTCGAGAAATTGCTCGCTTGCCAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-398s21c1
Sequence:CCGGAGTCGAGTTGTATCGCATTAACTCGAGTTAATGCGATACAACTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-550s21c1
Sequence:CCGGTCCCGCAAAGCTTTGACAAAGCTCGAGCTTTGTCAAAGCTTTGCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-483s21c1
Sequence:CCGGGCCATGTTCTTCATCGGTTTCCTCGAGGAAACCGATGAAGAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-221s21c1
Sequence:CCGGGTGTGTACGAGCTCATGAAAGCTCGAGCTTTCATGAGCTCGTACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-509s1c1
Sequence:CCGGGCTCGTTATCATGTGGCAGAACTCGAGTTCTGCCACATGATAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-401s1c1
Sequence:CCGGCGAGTTGTATCGCATTAAGTTCTCGAGAACTTAATGCGATACAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001861.2-482s1c1
Sequence:CCGGTGCCATGTTCTTCATCGGTTTCTCGAGAAACCGATGAAGAACATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-633s1c1
Sequence:CCGGGCCTCCAAGTGGGACTACGAACTCGAGTTCGTAGTCCCACTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-230s1c1
Sequence:CCGGAGCTCATGAAAGTGTTGTGAACTCGAGTTCACAACACTTTCATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001861
VALIDATED
COX4I1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit IV isoform 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-190s21c1
Sequence:CCGGTAGTTGGCAAGCGAGCAATTTCTCGAGAAATTGCTCGCTTGCCAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-398s21c1
Sequence:CCGGAGTCGAGTTGTATCGCATTAACTCGAGTTAATGCGATACAACTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-550s21c1
Sequence:CCGGTCCCGCAAAGCTTTGACAAAGCTCGAGCTTTGTCAAAGCTTTGCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-483s21c1
Sequence:CCGGGCCATGTTCTTCATCGGTTTCCTCGAGGAAACCGATGAAGAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-221s21c1
Sequence:CCGGGTGTGTACGAGCTCATGAAAGCTCGAGCTTTCATGAGCTCGTACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-509s1c1
Sequence:CCGGGCTCGTTATCATGTGGCAGAACTCGAGTTCTGCCACATGATAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-401s1c1
Sequence:CCGGCGAGTTGTATCGCATTAAGTTCTCGAGAACTTAATGCGATACAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001861.2-482s1c1
Sequence:CCGGTGCCATGTTCTTCATCGGTTTCTCGAGAAACCGATGAAGAACATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-633s1c1
Sequence:CCGGGCCTCCAAGTGGGACTACGAACTCGAGTTCGTAGTCCCACTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-230s1c1
Sequence:CCGGAGCTCATGAAAGTGTTGTGAACTCGAGTTCACAACACTTTCATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001861
VALIDATED
COX4I1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit IV isoform 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-190s21c1
Sequence:CCGGTAGTTGGCAAGCGAGCAATTTCTCGAGAAATTGCTCGCTTGCCAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-398s21c1
Sequence:CCGGAGTCGAGTTGTATCGCATTAACTCGAGTTAATGCGATACAACTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-550s21c1
Sequence:CCGGTCCCGCAAAGCTTTGACAAAGCTCGAGCTTTGTCAAAGCTTTGCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-483s21c1
Sequence:CCGGGCCATGTTCTTCATCGGTTTCCTCGAGGAAACCGATGAAGAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001861.2-221s21c1
Sequence:CCGGGTGTGTACGAGCTCATGAAAGCTCGAGCTTTCATGAGCTCGTACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-509s1c1
Sequence:CCGGGCTCGTTATCATGTGGCAGAACTCGAGTTCTGCCACATGATAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-401s1c1
Sequence:CCGGCGAGTTGTATCGCATTAAGTTCTCGAGAACTTAATGCGATACAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001861.2-482s1c1
Sequence:CCGGTGCCATGTTCTTCATCGGTTTCTCGAGAAACCGATGAAGAACATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-633s1c1
Sequence:CCGGGCCTCCAAGTGGGACTACGAACTCGAGTTCGTAGTCCCACTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001861.2-230s1c1
Sequence:CCGGAGCTCATGAAAGTGTTGTGAACTCGAGTTCACAACACTTTCATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)