EMAIL THIS PAGE TO A FRIEND

COX4I1P1

cytochrome c oxidase subunit IV isoform 1 pseudogene 1

Gene Product Result for
Synonyms: COX4L1 COX4P1
Species: Human COX4I1P1(122867)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_063336
COX4I1P1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit IV isoform 1 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-61s1c1
Sequence:CCGGGTACGAGCACACGGAAATGTTCTCGAGAACATTTCCGTGTGCTCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-36s1c1
Sequence:CCGGGCGAGCAATTTCCACCTTGGTCTCGAGACCAAGGTGGAAATTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-124s1c1
Sequence:CCGGCGTGACTATCCCGTACCCGATCTCGAGATCGGGTACGGGATAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-237s1c1
Sequence:CCGGCGAGTTGTATCACATTCAGTTCTCGAGAACTGAATGTGATACAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-170s1c1
Sequence:CCGGCCAGACAGAAAGCCGTGAAGACTCGAGTCTTCACGGCTTTCTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_063336
COX4I1P1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit IV isoform 1 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-61s1c1
Sequence:CCGGGTACGAGCACACGGAAATGTTCTCGAGAACATTTCCGTGTGCTCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-36s1c1
Sequence:CCGGGCGAGCAATTTCCACCTTGGTCTCGAGACCAAGGTGGAAATTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-124s1c1
Sequence:CCGGCGTGACTATCCCGTACCCGATCTCGAGATCGGGTACGGGATAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-237s1c1
Sequence:CCGGCGAGTTGTATCACATTCAGTTCTCGAGAACTGAATGTGATACAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-170s1c1
Sequence:CCGGCCAGACAGAAAGCCGTGAAGACTCGAGTCTTCACGGCTTTCTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_063336
COX4I1P1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit IV isoform 1 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-61s1c1
Sequence:CCGGGTACGAGCACACGGAAATGTTCTCGAGAACATTTCCGTGTGCTCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-36s1c1
Sequence:CCGGGCGAGCAATTTCCACCTTGGTCTCGAGACCAAGGTGGAAATTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-124s1c1
Sequence:CCGGCGTGACTATCCCGTACCCGATCTCGAGATCGGGTACGGGATAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-237s1c1
Sequence:CCGGCGAGTTGTATCACATTCAGTTCTCGAGAACTGAATGTGATACAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_063336.1-170s1c1
Sequence:CCGGCCAGACAGAAAGCCGTGAAGACTCGAGTCTTCACGGCTTTCTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)