EMAIL THIS PAGE TO A FRIEND

COX4I2

cytochrome c oxidase subunit IV isoform 2 (lung)

62 Gene Product Result for
Synonyms: COX4 COX4-2 COX4B COX4L2 COXIV-2 dJ857M17.2
UniProtKB ID: Q96KJ9, Q6GTF4, Q9H0Z4
Gene ID:
Human(84701) Summary: Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes isoform 2 of subunit IV. Isoform 1 of subunit IV is encoded by a different gene, however, the two genes show a similar structural organization. Subunit IV is the largest nuclear encoded subunit which plays a pivotal role in COX regulation. [provided by RefSeq, Jul 2008]
Mouse(84682) cytochrome c oxidase subunit IV isoform 2
Rat(84683) cytochrome c oxidase subunit IV isoform 2 (lung)
Zebrafish(393776) cytochrome c oxidase subunit IV isoform 2
cow(618339) cytochrome c oxidase subunit IV isoform 2 (lung)
Horse(100053548) cytochrome c oxidase subunit 4 isoform 2, mitochondrial
dog(485825) cytochrome c oxidase subunit IV isoform 2 (lung)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032609 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032609 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032609 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032609 Rosetta Predictions human pricing
NM_053472 Rosetta Predictions rat pricing
NM_053091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023623 predicted 311
2 SASI_Hs01_00023624 predicted 385
3 SASI_Hs02_00360165 predicted 313
4 SASI_Hs01_00023627 predicted 444
5 SASI_Hs01_00023628 predicted 373
6 SASI_Hs01_00023629 predicted 442
7 SASI_Hs01_00023630 predicted 418
8 SASI_Hs02_00360166 predicted 336
9 SASI_Hs01_00023631 predicted 349
10 SASI_Hs02_00360167 predicted 330
11 SASI_Hs01_00023625 predicted 390
12 SASI_Hs01_00023626 predicted 391
13 SASI_Hs01_00023632 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051913 predicted 264
2 SASI_Rn01_00051914 predicted 200
3 SASI_Rn01_00051915 predicted 268
4 SASI_Rn01_00051917 predicted 291
5 SASI_Rn01_00051918 predicted 312
6 SASI_Rn01_00051919 predicted 229
7 SASI_Rn01_00051920 predicted 330
8 SASI_Rn01_00051921 predicted 206
9 SASI_Rn02_00266062 predicted 311
10 SASI_Rn02_00266063 predicted 270
11 SASI_Rn01_00051912 predicted 257
12 SASI_Rn01_00051916 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179235 predicted 298
2 SASI_Mm01_00179236 predicted 299
3 SASI_Mm01_00179237 predicted 364
4 SASI_Mm01_00179238 predicted 367
5 SASI_Mm01_00179239 predicted 194
6 SASI_Mm01_00179240 predicted 327
7 SASI_Mm01_00179241 predicted 376
8 SASI_Mm01_00179242 predicted 294
9 SASI_Mm01_00179243 predicted 339
10 SASI_Mm01_00179244 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032609
COX4I2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit IV isoform 2 (lung)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-330s1c1
Sequence:CCGGGCTCCAGTTCAATGAGACCTTCTCGAGAAGGTCTCATTGAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-416s1c1
Sequence:CCGGGATTCGCAGCTCTGGTGATTTCTCGAGAAATCACCAGAGCTGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-130s1c1
Sequence:CCGGCGAGGGATGCACAGCTCAGAACTCGAGTTCTGAGCTGTGCATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-228s1c1
Sequence:CCGGGCCCTTCTGCACAGAACTCAACTCGAGTTGAGTTCTGTGCAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-363s1c1
Sequence:CCGGCCGTCGCTCCAATGAGTGGAACTCGAGTTCCACTCATTGGAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032609
COX4I2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit IV isoform 2 (lung)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-330s1c1
Sequence:CCGGGCTCCAGTTCAATGAGACCTTCTCGAGAAGGTCTCATTGAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-416s1c1
Sequence:CCGGGATTCGCAGCTCTGGTGATTTCTCGAGAAATCACCAGAGCTGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-130s1c1
Sequence:CCGGCGAGGGATGCACAGCTCAGAACTCGAGTTCTGAGCTGTGCATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-228s1c1
Sequence:CCGGGCCCTTCTGCACAGAACTCAACTCGAGTTGAGTTCTGTGCAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-363s1c1
Sequence:CCGGCCGTCGCTCCAATGAGTGGAACTCGAGTTCCACTCATTGGAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032609
COX4I2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit IV isoform 2 (lung)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-330s1c1
Sequence:CCGGGCTCCAGTTCAATGAGACCTTCTCGAGAAGGTCTCATTGAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-416s1c1
Sequence:CCGGGATTCGCAGCTCTGGTGATTTCTCGAGAAATCACCAGAGCTGCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-130s1c1
Sequence:CCGGCGAGGGATGCACAGCTCAGAACTCGAGTTCTGAGCTGTGCATCCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-228s1c1
Sequence:CCGGGCCCTTCTGCACAGAACTCAACTCGAGTTGAGTTCTGTGCAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032609.2-363s1c1
Sequence:CCGGCCGTCGCTCCAATGAGTGGAACTCGAGTTCCACTCATTGGAGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053091
VALIDATED
COX4I2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit IV isoform 2 (lung)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053091.1-319s1c1
Sequence:CCGGCCATGAAACCTTCGCAGAGATCTCGAGATCTCTGCGAAGGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-424s1c1
Sequence:CCGGGCGAGTCTATGTGTTCCCTAACTCGAGTTAGGGAACACATAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-185s1c1
Sequence:CCGGCGCTCCTATCCCATGCCGGATCTCGAGATCCGGCATGGGATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053091.1-343s1c1
Sequence:CCGGCCATCGCTCCAACGAATGGAACTCGAGTTCCATTCGTTGGAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-427s1c1
Sequence:CCGGAGTCTATGTGTTCCCTAAGAACTCGAGTTCTTAGGGAACACATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053091
VALIDATED
COX4I2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit IV isoform 2 (lung)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053091.1-319s1c1
Sequence:CCGGCCATGAAACCTTCGCAGAGATCTCGAGATCTCTGCGAAGGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-424s1c1
Sequence:CCGGGCGAGTCTATGTGTTCCCTAACTCGAGTTAGGGAACACATAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-185s1c1
Sequence:CCGGCGCTCCTATCCCATGCCGGATCTCGAGATCCGGCATGGGATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053091.1-343s1c1
Sequence:CCGGCCATCGCTCCAACGAATGGAACTCGAGTTCCATTCGTTGGAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-427s1c1
Sequence:CCGGAGTCTATGTGTTCCCTAAGAACTCGAGTTCTTAGGGAACACATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053091
VALIDATED
COX4I2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit IV isoform 2 (lung)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053091.1-319s1c1
Sequence:CCGGCCATGAAACCTTCGCAGAGATCTCGAGATCTCTGCGAAGGTTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-424s1c1
Sequence:CCGGGCGAGTCTATGTGTTCCCTAACTCGAGTTAGGGAACACATAGACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-185s1c1
Sequence:CCGGCGCTCCTATCCCATGCCGGATCTCGAGATCCGGCATGGGATAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053091.1-343s1c1
Sequence:CCGGCCATCGCTCCAACGAATGGAACTCGAGTTCCATTCGTTGGAGCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053091.1-427s1c1
Sequence:CCGGAGTCTATGTGTTCCCTAAGAACTCGAGTTCTTAGGGAACACATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks