EMAIL THIS PAGE TO A FRIEND

COX5A

cytochrome c oxidase subunit Va

60 Gene Product Result for
Synonyms: COX COX-VA VA
UniProtKB ID: P20674, P30045, Q8TB65
Gene ID:
Human(9377) Summary: Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer of proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Va of the human mitochondrial respiratory chain enzyme. A pseudogene COX5AP1 has been found in chromosome 14q22. [provided by RefSeq, Jul 2008]
Mouse(12858) cytochrome c oxidase subunit Va
Rat(252934) cytochrome c oxidase, subunit Va
chicken(769735) cytochrome c oxidase subunit Va
cow(444878) cytochrome c oxidase subunit Va
dog(478370) cytochrome c oxidase subunit Va
sheep(100170667) cytochrome oxidase subunit Va
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004255 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004255 Rosetta Predictions human pricing
NM_145783 Rosetta Predictions rat pricing
NM_007747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094458 predicted 249
2 SASI_Hs01_00094459 predicted 216
3 SASI_Hs01_00094460 predicted 380
4 SASI_Hs01_00094461 predicted 219
5 SASI_Hs01_00094462 predicted 323
6 SASI_Hs01_00094464 predicted 287
7 SASI_Hs01_00094466 predicted 360
8 SASI_Hs01_00094467 predicted 228
9 SASI_Hs02_00337200 predicted 336
10 SASI_Hs02_00337201 predicted 400
11 SASI_Hs01_00094463 predicted 399
12 SASI_Hs01_00094465 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075072 predicted 346
2 SASI_Rn01_00075075 predicted 215
3 SASI_Rn01_00075076 predicted 274
4 SASI_Rn02_00268791 predicted 202
5 SASI_Rn02_00268792 predicted 271
6 SASI_Rn01_00075077 predicted 313
7 SASI_Rn01_00075080 predicted 211
8 SASI_Rn01_00075081 predicted 336
9 SASI_Rn02_00268793 predicted 345
10 SASI_Rn02_00268794 predicted 200
11 SASI_Rn01_00075073 predicted 239
12 SASI_Rn01_00075074 predicted 367
13 SASI_Rn01_00075078 predicted 336
14 SASI_Rn01_00075079 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312349 predicted 436
2 SASI_Mm02_00312350 predicted 240
3 SASI_Mm02_00312351 predicted 254
4 SASI_Mm02_00312352 predicted 247
5 SASI_Mm01_00033943 predicted 300
6 SASI_Mm02_00312353 predicted 460
7 SASI_Mm02_00312354 predicted 286
8 SASI_Mm01_00033944 predicted 401
9 SASI_Mm02_00312355 predicted 467
10 SASI_Mm01_00033945 predicted 364
11 SASI_Mm01_00033946 predicted 378
12 SASI_Mm01_00033947 predicted 332
13 SASI_Mm01_00033948 predicted 213
14 SASI_Mm01_00033949 predicted 273
15 SASI_Mm01_00033950 predicted 222
16 SASI_Mm01_00033951 predicted 214
17 SASI_Mm01_00033952 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007747
COX5A MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit Va
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-219s1c1
Sequence:CCGGCGTAAAGGGATGAATACACTTCTCGAGAAGTGTATTCATCCCTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-112s1c1
Sequence:CCGGTCTGTTCCATTCGGTGCTATTCTCGAGAATAGCACCGAATGGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007747.1-463s1c1
Sequence:CCGGCTCCCTTCGATGGGCTTCCTACTCGAGTAGGAAGCCCATCGAAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-363s1c1
Sequence:CCGGCATAAGGAAATCTATCCCTATCTCGAGATAGGGATAGATTTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-287s1c1
Sequence:CCGGGCGAGCATGTAGACGGTTAAACTCGAGTTTAACCGTCTACATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007747.2-462s21c1
Sequence:CCGGCATCCAGGAACTTAGACCAACCTCGAGGTTGGTCTAAGTTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007747.2-402s21c1
Sequence:CCGGTCGCATCTTGGAGGTTGTTAACTCGAGTTAACAACCTCCAAGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007747
COX5A MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit Va
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-219s1c1
Sequence:CCGGCGTAAAGGGATGAATACACTTCTCGAGAAGTGTATTCATCCCTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-112s1c1
Sequence:CCGGTCTGTTCCATTCGGTGCTATTCTCGAGAATAGCACCGAATGGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007747.1-463s1c1
Sequence:CCGGCTCCCTTCGATGGGCTTCCTACTCGAGTAGGAAGCCCATCGAAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-363s1c1
Sequence:CCGGCATAAGGAAATCTATCCCTATCTCGAGATAGGGATAGATTTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-287s1c1
Sequence:CCGGGCGAGCATGTAGACGGTTAAACTCGAGTTTAACCGTCTACATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007747.2-462s21c1
Sequence:CCGGCATCCAGGAACTTAGACCAACCTCGAGGTTGGTCTAAGTTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007747.2-402s21c1
Sequence:CCGGTCGCATCTTGGAGGTTGTTAACTCGAGTTAACAACCTCCAAGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007747
COX5A MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit Va
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-219s1c1
Sequence:CCGGCGTAAAGGGATGAATACACTTCTCGAGAAGTGTATTCATCCCTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-112s1c1
Sequence:CCGGTCTGTTCCATTCGGTGCTATTCTCGAGAATAGCACCGAATGGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007747.1-463s1c1
Sequence:CCGGCTCCCTTCGATGGGCTTCCTACTCGAGTAGGAAGCCCATCGAAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-363s1c1
Sequence:CCGGCATAAGGAAATCTATCCCTATCTCGAGATAGGGATAGATTTCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007747.1-287s1c1
Sequence:CCGGGCGAGCATGTAGACGGTTAAACTCGAGTTTAACCGTCTACATGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007747.2-462s21c1
Sequence:CCGGCATCCAGGAACTTAGACCAACCTCGAGGTTGGTCTAAGTTCCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007747.2-402s21c1
Sequence:CCGGTCGCATCTTGGAGGTTGTTAACTCGAGTTAACAACCTCCAAGATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004255
VALIDATED
COX5A MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit Va
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-204s1c1
Sequence:CCGGCCAGATATAGATGCCTGGGAACTCGAGTTCCCAGGCATCTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-400s1c1
Sequence:CCGGAGGAACTTAGACCAACTTTAACTCGAGTTAAAGTTGGTCTAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-324s1c1
Sequence:CCGGGCTAGTCTAGTTCGAATCCTACTCGAGTAGGATTCGAACTAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-121s1c1
Sequence:CCGGTCCAGTCAGTTCGCTGCTATTCTCGAGAATAGCAGCGAACTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004255.2-241s1c1
Sequence:CCGGACACACTTGTTACCTATGATACTCGAGTATCATAGGTAACAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004255
VALIDATED
COX5A MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit Va
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-204s1c1
Sequence:CCGGCCAGATATAGATGCCTGGGAACTCGAGTTCCCAGGCATCTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-400s1c1
Sequence:CCGGAGGAACTTAGACCAACTTTAACTCGAGTTAAAGTTGGTCTAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-324s1c1
Sequence:CCGGGCTAGTCTAGTTCGAATCCTACTCGAGTAGGATTCGAACTAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-121s1c1
Sequence:CCGGTCCAGTCAGTTCGCTGCTATTCTCGAGAATAGCAGCGAACTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004255.2-241s1c1
Sequence:CCGGACACACTTGTTACCTATGATACTCGAGTATCATAGGTAACAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004255
VALIDATED
COX5A MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit Va
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-204s1c1
Sequence:CCGGCCAGATATAGATGCCTGGGAACTCGAGTTCCCAGGCATCTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-400s1c1
Sequence:CCGGAGGAACTTAGACCAACTTTAACTCGAGTTAAAGTTGGTCTAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-324s1c1
Sequence:CCGGGCTAGTCTAGTTCGAATCCTACTCGAGTAGGATTCGAACTAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004255.2-121s1c1
Sequence:CCGGTCCAGTCAGTTCGCTGCTATTCTCGAGAATAGCAGCGAACTGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004255.2-241s1c1
Sequence:CCGGACACACTTGTTACCTATGATACTCGAGTATCATAGGTAACAAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks