EMAIL THIS PAGE TO A FRIEND

COX6A1

cytochrome c oxidase subunit VIa polypeptide 1

55 Gene Product Result for
Synonyms: COX6A COX6AL
UniProtKB ID: P12074, B2R500, O43714, Q32Q37
Gene ID:
Human(1337) Summary: Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in the electron transfer and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (liver isoform) of subunit VIa, and polypeptide 1 is found in all non-muscle tissues. Polypeptide 2 (heart/muscle isoform) of subunit VIa is encoded by a different gene, and is present only in striated muscles. These two polypeptides share 66% amino acid sequence identity. It has been reported that there may be several pseudogenes on chromosomes 1, 6, 7q21, 7q31-32 and 12. However, only one pseudogene (COX6A1P) on chromosome 1p31.1 has been documented. [provided by RefSeq, Jul 2008]
Mouse(12861) cytochrome c oxidase subunit VIa polypeptide 1
Rat(25282) cytochrome c oxidase, subunit VIa, polypeptide 1
Domestic Rabbit(100327270) cytochrome c oxidase subunit VIa
Zebrafish(335774) cytochrome c oxidase subunit VIa polypeptide 1
chicken(416978) cytochrome c oxidase subunit VIa polypeptide 1
cow(282199) cytochrome c oxidase subunit VIa polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004373 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004373 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004373 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004373 Rosetta Predictions human pricing
NM_012814 Rosetta Predictions rat pricing
NM_007748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142471 predicted 290
2 SASI_Hs01_00142472 predicted 280
3 SASI_Hs01_00142473 predicted 284
4 SASI_Hs01_00142474 predicted 288
5 SASI_Hs01_00142475 predicted 226
6 SASI_Hs01_00142476 predicted 312
7 SASI_Hs01_00142477 predicted 288
8 SASI_Hs01_00142478 predicted 294
9 SASI_Hs01_00142479 predicted 284
10 SASI_Hs01_00142480 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078415 predicted 292
2 SASI_Rn01_00078416 predicted 323
3 SASI_Rn01_00078417 predicted 322
4 SASI_Rn01_00078418 predicted 295
5 SASI_Rn01_00078419 predicted 324
6 SASI_Rn01_00078420 predicted 310
7 SASI_Rn01_00078421 predicted 226
8 SASI_Rn01_00078422 predicted 286
9 SASI_Rn01_00078423 predicted 281
10 SASI_Rn01_00078424 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076633 predicted 275
2 SASI_Mm01_00076634 predicted 282
3 SASI_Mm01_00076631 predicted 305
4 SASI_Mm01_00076635 predicted 296
5 SASI_Mm01_00076636 predicted 289
6 SASI_Mm01_00076637 predicted 265
7 SASI_Mm02_00312356 predicted 307
8 SASI_Mm01_00076639 predicted 282
9 SASI_Mm01_00076632 predicted 236
10 SASI_Mm01_00076640 predicted 272
11 SASI_Mm01_00076638 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007748
VALIDATED
COX6A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIa polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-458s1c1
Sequence:CCGGGATGGCGACCATTACTCTGATCTCGAGATCAGAGTAATGGTCGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-323s1c1
Sequence:CCGGGACCGGCTATGAAGATGAGTACTCGAGTACTCATCTTCATAGCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007748.2-173s1c1
Sequence:CCGGCATGCTCAACGTGTTCCTCAACTCGAGTTGAGGAACACGTTGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-275s1c1
Sequence:CCGGAGACGGTAACCATACCCTCTTCTCGAGAAGAGGGTATGGTTACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-122s1c1
Sequence:CCGGGATGTGGAAGGCCCTCACCTACTCGAGTAGGTGAGGGCCTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007748.3-458s21c1
Sequence:CCGGGATGGCGACCATTACTCTGATCTCGAGATCAGAGTAATGGTCGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-323s21c1
Sequence:CCGGGACCGGCTATGAAGATGAGTACTCGAGTACTCATCTTCATAGCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-122s21c1
Sequence:CCGGGATGTGGAAGGCCCTCACCTACTCGAGTAGGTGAGGGCCTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-275s21c1
Sequence:CCGGAGACGGTAACCATACCCTCTTCTCGAGAAGAGGGTATGGTTACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007748
VALIDATED
COX6A1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIa polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-458s1c1
Sequence:CCGGGATGGCGACCATTACTCTGATCTCGAGATCAGAGTAATGGTCGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-323s1c1
Sequence:CCGGGACCGGCTATGAAGATGAGTACTCGAGTACTCATCTTCATAGCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007748.2-173s1c1
Sequence:CCGGCATGCTCAACGTGTTCCTCAACTCGAGTTGAGGAACACGTTGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-275s1c1
Sequence:CCGGAGACGGTAACCATACCCTCTTCTCGAGAAGAGGGTATGGTTACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-122s1c1
Sequence:CCGGGATGTGGAAGGCCCTCACCTACTCGAGTAGGTGAGGGCCTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007748.3-458s21c1
Sequence:CCGGGATGGCGACCATTACTCTGATCTCGAGATCAGAGTAATGGTCGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-323s21c1
Sequence:CCGGGACCGGCTATGAAGATGAGTACTCGAGTACTCATCTTCATAGCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-122s21c1
Sequence:CCGGGATGTGGAAGGCCCTCACCTACTCGAGTAGGTGAGGGCCTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-275s21c1
Sequence:CCGGAGACGGTAACCATACCCTCTTCTCGAGAAGAGGGTATGGTTACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007748
VALIDATED
COX6A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIa polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-458s1c1
Sequence:CCGGGATGGCGACCATTACTCTGATCTCGAGATCAGAGTAATGGTCGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-323s1c1
Sequence:CCGGGACCGGCTATGAAGATGAGTACTCGAGTACTCATCTTCATAGCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007748.2-173s1c1
Sequence:CCGGCATGCTCAACGTGTTCCTCAACTCGAGTTGAGGAACACGTTGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-275s1c1
Sequence:CCGGAGACGGTAACCATACCCTCTTCTCGAGAAGAGGGTATGGTTACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007748.2-122s1c1
Sequence:CCGGGATGTGGAAGGCCCTCACCTACTCGAGTAGGTGAGGGCCTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007748.3-458s21c1
Sequence:CCGGGATGGCGACCATTACTCTGATCTCGAGATCAGAGTAATGGTCGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-323s21c1
Sequence:CCGGGACCGGCTATGAAGATGAGTACTCGAGTACTCATCTTCATAGCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-122s21c1
Sequence:CCGGGATGTGGAAGGCCCTCACCTACTCGAGTAGGTGAGGGCCTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007748.3-275s21c1
Sequence:CCGGAGACGGTAACCATACCCTCTTCTCGAGAAGAGGGTATGGTTACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004373
VALIDATED
COX6A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIa polypeptide 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-292s1c1
Sequence:CCGGGTAACCATACTCTATTCCATACTCGAGTATGGAATAGAGTATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-116s1c1
Sequence:CCGGCGAAGAGGGCTCAGCTCGCATCTCGAGATGCGAGCTGAGCCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-333s1c1
Sequence:CCGGCCAACTGGCTACGAAGATGAACTCGAGTTCATCTTCGTAGCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-316s1c1
Sequence:CCGGCTCATGTGAATCCACTTCCAACTCGAGTTGGAAGTGGATTCACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-185s1c1
Sequence:CCGGCATGCTGAATGTGTACCTGAACTCGAGTTCAGGTACACATTCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-288s21c1
Sequence:GTACCGGGATGGTAACCATACTCTATTCCTCGAGGAATAGAGTATGGTTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-357s21c1
Sequence:CCGGAGAGAATCTGGACCACTACCCCTCGAGGGGTAGTGGTCCAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-337s21c1
Sequence:CCGGCTGGCTACGAAGATGAATAAACTCGAGTTTATTCATCTTCGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-307s21c1
Sequence:CCGGTCCATAACCCTCATGTGAATCCTCGAGGATTCACATGAGGGTTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-175s21c1
Sequence:CCGGTGGCAGTCAGCATGCTGAATGCTCGAGCATTCAGCATGCTGACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004373
VALIDATED
COX6A1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIa polypeptide 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-292s1c1
Sequence:CCGGGTAACCATACTCTATTCCATACTCGAGTATGGAATAGAGTATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-116s1c1
Sequence:CCGGCGAAGAGGGCTCAGCTCGCATCTCGAGATGCGAGCTGAGCCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-333s1c1
Sequence:CCGGCCAACTGGCTACGAAGATGAACTCGAGTTCATCTTCGTAGCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-316s1c1
Sequence:CCGGCTCATGTGAATCCACTTCCAACTCGAGTTGGAAGTGGATTCACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-185s1c1
Sequence:CCGGCATGCTGAATGTGTACCTGAACTCGAGTTCAGGTACACATTCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-288s21c1
Sequence:GTACCGGGATGGTAACCATACTCTATTCCTCGAGGAATAGAGTATGGTTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-357s21c1
Sequence:CCGGAGAGAATCTGGACCACTACCCCTCGAGGGGTAGTGGTCCAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-337s21c1
Sequence:CCGGCTGGCTACGAAGATGAATAAACTCGAGTTTATTCATCTTCGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-307s21c1
Sequence:CCGGTCCATAACCCTCATGTGAATCCTCGAGGATTCACATGAGGGTTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-175s21c1
Sequence:CCGGTGGCAGTCAGCATGCTGAATGCTCGAGCATTCAGCATGCTGACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004373
VALIDATED
COX6A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIa polypeptide 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-292s1c1
Sequence:CCGGGTAACCATACTCTATTCCATACTCGAGTATGGAATAGAGTATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-116s1c1
Sequence:CCGGCGAAGAGGGCTCAGCTCGCATCTCGAGATGCGAGCTGAGCCCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-333s1c1
Sequence:CCGGCCAACTGGCTACGAAGATGAACTCGAGTTCATCTTCGTAGCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-316s1c1
Sequence:CCGGCTCATGTGAATCCACTTCCAACTCGAGTTGGAAGTGGATTCACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004373.2-185s1c1
Sequence:CCGGCATGCTGAATGTGTACCTGAACTCGAGTTCAGGTACACATTCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-288s21c1
Sequence:GTACCGGGATGGTAACCATACTCTATTCCTCGAGGAATAGAGTATGGTTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-357s21c1
Sequence:CCGGAGAGAATCTGGACCACTACCCCTCGAGGGGTAGTGGTCCAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-337s21c1
Sequence:CCGGCTGGCTACGAAGATGAATAAACTCGAGTTTATTCATCTTCGTAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-307s21c1
Sequence:CCGGTCCATAACCCTCATGTGAATCCTCGAGGATTCACATGAGGGTTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004373.2-175s21c1
Sequence:CCGGTGGCAGTCAGCATGCTGAATGCTCGAGCATTCAGCATGCTGACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks