EMAIL THIS PAGE TO A FRIEND

COX6A1P2

cytochrome c oxidase subunit VIa polypeptide 1 pseudogene 2

Gene Product Result for
Species: Human COX6A1P2(285849)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_208356
COX6A1P2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIa polypeptide 1 pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-282s1c1
Sequence:CCGGGAGATGGTAACCATACTCTATCTCGAGATAGAGTATGGTTACCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-217s1c1
Sequence:CCGGGCACGAGAGACCCGAGTTCATCTCGAGATGAACTCGGGTCTCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-130s1c1
Sequence:CCGGCATGTGGAAGACCCTCACCTTCTCGAGAAGGTGAGGGTCTTCCACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-319s1c1
Sequence:CCGGGAATCCACTTCCAACTGGCTACTCGAGTAGCCAGTTGGAAGTGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-296s1c1
Sequence:CCGGACTCTATTCCATAACCCTCATCTCGAGATGAGGGTTATGGAATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_208356
COX6A1P2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIa polypeptide 1 pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-282s1c1
Sequence:CCGGGAGATGGTAACCATACTCTATCTCGAGATAGAGTATGGTTACCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-217s1c1
Sequence:CCGGGCACGAGAGACCCGAGTTCATCTCGAGATGAACTCGGGTCTCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-130s1c1
Sequence:CCGGCATGTGGAAGACCCTCACCTTCTCGAGAAGGTGAGGGTCTTCCACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-319s1c1
Sequence:CCGGGAATCCACTTCCAACTGGCTACTCGAGTAGCCAGTTGGAAGTGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-296s1c1
Sequence:CCGGACTCTATTCCATAACCCTCATCTCGAGATGAGGGTTATGGAATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_208356
COX6A1P2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIa polypeptide 1 pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-282s1c1
Sequence:CCGGGAGATGGTAACCATACTCTATCTCGAGATAGAGTATGGTTACCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-217s1c1
Sequence:CCGGGCACGAGAGACCCGAGTTCATCTCGAGATGAACTCGGGTCTCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-130s1c1
Sequence:CCGGCATGTGGAAGACCCTCACCTTCTCGAGAAGGTGAGGGTCTTCCACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-319s1c1
Sequence:CCGGGAATCCACTTCCAACTGGCTACTCGAGTAGCCAGTTGGAAGTGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_208356.4-296s1c1
Sequence:CCGGACTCTATTCCATAACCCTCATCTCGAGATGAGGGTTATGGAATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)