EMAIL THIS PAGE TO A FRIEND

COX6A2

cytochrome c oxidase subunit VIa polypeptide 2

54 Gene Product Result for
Synonyms: COX6AH COXVIAH
UniProtKB ID: Q02221, O00761, Q6GTW6
Gene ID:
Human(1339) Summary: Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (heart/muscle isoform) of subunit VIa, and polypeptide 2 is present only in striated muscles. Polypeptide 1 (liver isoform) of subunit VIa is encoded by a different gene, and is found in all non-muscle tissues. These two polypeptides share 66% amino acid sequence identity. [provided by RefSeq, Jul 2008]
Mouse(12862) cytochrome c oxidase subunit VIa polypeptide 2
Rat(25278) cytochrome c oxidase subunit VIa polypeptide 2
Zebrafish(447942) cytochrome c oxidase subunit VIa polypeptide 2
cow(282200) cytochrome c oxidase subunit VIa polypeptide 2
dog(479780) cytochrome c oxidase subunit VIa polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005205 Rosetta Predictions human pricing
NM_001109994 Rosetta Predictions rat pricing
NM_012812 Rosetta Predictions rat pricing
NM_009943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234111 predicted 145
2 SASI_Hs01_00234112 predicted 105
3 SASI_Hs01_00234113 predicted 309
4 SASI_Hs01_00234114 predicted 195
5 SASI_Hs01_00234115 predicted 267
6 SASI_Hs01_00234116 predicted 307
7 SASI_Hs01_00234117 predicted 325
8 SASI_Hs01_00234118 predicted 296
9 SASI_Hs01_00234119 predicted 262
10 SASI_Hs01_00234120 predicted 141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250962 predicted 376
2 SASI_Rn02_00250963 predicted 368
3 SASI_Rn02_00250964 predicted 308
4 SASI_Rn02_00250965 predicted 303
5 SASI_Rn02_00250966 predicted 254
6 SASI_Rn02_00250967 predicted 280
7 SASI_Rn02_00250968 predicted 307
8 SASI_Rn02_00250969 predicted 272
9 SASI_Rn02_00250970 predicted 296
10 SASI_Rn02_00250971 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065109 predicted 198
2 SASI_Rn01_00065102 predicted 411
3 SASI_Rn01_00065103 predicted 405
4 SASI_Rn02_00260260 predicted 343
5 SASI_Rn01_00065105 predicted 298
6 SASI_Rn01_00065106 predicted 318
7 SASI_Rn01_00065104 predicted 348
8 SASI_Rn01_00065110 predicted 159
9 SASI_Rn02_00260261 predicted 395
10 SASI_Rn02_00260262 predicted 161
11 SASI_Rn01_00065107 predicted 291
12 SASI_Rn01_00065108 predicted 149
13 SASI_Rn01_00065111 predicted 133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159851 predicted 229
2 SASI_Mm01_00159852 predicted 328
3 SASI_Mm01_00159853 predicted 317
4 SASI_Mm01_00159854 predicted 234
5 SASI_Mm01_00159855 predicted 235
6 SASI_Mm01_00159856 predicted 217
7 SASI_Mm01_00159857 predicted 261
8 SASI_Mm01_00159858 predicted 330
9 SASI_Mm01_00159859 predicted 228
10 SASI_Mm01_00159860 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005205
COX6A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIa polypeptide 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-201s1c1
Sequence:CCGGCTGCACCTTCAACTCCTATCTCTCGAGAGATAGGAGTTGAAGGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-255s1c1
Sequence:CCGGTCCCTACCAACACCTCCGCATCTCGAGATGCGGAGGTGTTGGTAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-147s1c1
Sequence:CCGGAGCTCGTACCTGGCGTCTGCTCTCGAGAGCAGACGCCAGGTACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-244s1c1
Sequence:CCGGCCCGAGTTCCGTCCCTACCAACTCGAGTTGGTAGGGACGGAACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-137s1c1
Sequence:CCGGGAGGAGCAGGAGCTCGTACCTCTCGAGAGGTACGAGCTCCTGCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005205
COX6A2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIa polypeptide 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-201s1c1
Sequence:CCGGCTGCACCTTCAACTCCTATCTCTCGAGAGATAGGAGTTGAAGGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-255s1c1
Sequence:CCGGTCCCTACCAACACCTCCGCATCTCGAGATGCGGAGGTGTTGGTAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-147s1c1
Sequence:CCGGAGCTCGTACCTGGCGTCTGCTCTCGAGAGCAGACGCCAGGTACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-244s1c1
Sequence:CCGGCCCGAGTTCCGTCCCTACCAACTCGAGTTGGTAGGGACGGAACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-137s1c1
Sequence:CCGGGAGGAGCAGGAGCTCGTACCTCTCGAGAGGTACGAGCTCCTGCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005205
COX6A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIa polypeptide 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-201s1c1
Sequence:CCGGCTGCACCTTCAACTCCTATCTCTCGAGAGATAGGAGTTGAAGGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-255s1c1
Sequence:CCGGTCCCTACCAACACCTCCGCATCTCGAGATGCGGAGGTGTTGGTAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-147s1c1
Sequence:CCGGAGCTCGTACCTGGCGTCTGCTCTCGAGAGCAGACGCCAGGTACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-244s1c1
Sequence:CCGGCCCGAGTTCCGTCCCTACCAACTCGAGTTGGTAGGGACGGAACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005205.2-137s1c1
Sequence:CCGGGAGGAGCAGGAGCTCGTACCTCTCGAGAGGTACGAGCTCCTGCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009943
COX6A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIa polypeptide 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-148s1c1
Sequence:CCGGCTGACCTTTGTGCTGGCTCTTCTCGAGAAGAGCCAGCACAAAGGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-252s1c1
Sequence:CCGGCCGCATCCGAACCAAGCCCTTCTCGAGAAGGGCTTGGTTCGGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-311s1c1
Sequence:CCGGCCCACGTCAATCCTTTGCCCACTCGAGTGGGCAAAGGATTGACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-97s1c1
Sequence:CCGGAGCGCAGCCAAAGGAGACCATCTCGAGATGGTCTCCTTTGGCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009943.2-447s21c1
Sequence:CCGGGACAGTTCCAAGCTCAATAAACTCGAGTTTATTGAGCTTGGAACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-223s1c2
Sequence:CCGGCGCCCAGAGTTCATCCCGTATCTCGAGATACGGGATGAACTCTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009943.2-198s21c1
Sequence:CCGGTGCTCCCTTAACTGCTGGATGCTCGAGCATCCAGCAGTTAAGGGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009943
COX6A2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIa polypeptide 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-148s1c1
Sequence:CCGGCTGACCTTTGTGCTGGCTCTTCTCGAGAAGAGCCAGCACAAAGGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-252s1c1
Sequence:CCGGCCGCATCCGAACCAAGCCCTTCTCGAGAAGGGCTTGGTTCGGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-311s1c1
Sequence:CCGGCCCACGTCAATCCTTTGCCCACTCGAGTGGGCAAAGGATTGACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-97s1c1
Sequence:CCGGAGCGCAGCCAAAGGAGACCATCTCGAGATGGTCTCCTTTGGCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009943.2-447s21c1
Sequence:CCGGGACAGTTCCAAGCTCAATAAACTCGAGTTTATTGAGCTTGGAACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-223s1c2
Sequence:CCGGCGCCCAGAGTTCATCCCGTATCTCGAGATACGGGATGAACTCTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009943.2-198s21c1
Sequence:CCGGTGCTCCCTTAACTGCTGGATGCTCGAGCATCCAGCAGTTAAGGGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009943
COX6A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIa polypeptide 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-148s1c1
Sequence:CCGGCTGACCTTTGTGCTGGCTCTTCTCGAGAAGAGCCAGCACAAAGGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-252s1c1
Sequence:CCGGCCGCATCCGAACCAAGCCCTTCTCGAGAAGGGCTTGGTTCGGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-311s1c1
Sequence:CCGGCCCACGTCAATCCTTTGCCCACTCGAGTGGGCAAAGGATTGACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-97s1c1
Sequence:CCGGAGCGCAGCCAAAGGAGACCATCTCGAGATGGTCTCCTTTGGCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009943.2-447s21c1
Sequence:CCGGGACAGTTCCAAGCTCAATAAACTCGAGTTTATTGAGCTTGGAACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009943.1-223s1c2
Sequence:CCGGCGCCCAGAGTTCATCCCGTATCTCGAGATACGGGATGAACTCTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009943.2-198s21c1
Sequence:CCGGTGCTCCCTTAACTGCTGGATGCTCGAGCATCCAGCAGTTAAGGGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)