EMAIL THIS PAGE TO A FRIEND

COX6B1

cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)

Synonyms: COX6B COXG COXVIb1
UniProtKB ID: P14854, B2R5C9, Q6IBL4
Gene ID:
Human(1340) Summary: Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIb. Mutations in this gene are associated with severe infantile encephalomyopathy. Three pseudogenes COX6BP-1, COX6BP-2 and COX6BP-3 have been found on chromosomes 7, 17 and 22q13.1-13.2, respectively. [provided by RefSeq, Jan 2010]
Mouse(110323) cytochrome c oxidase, subunit VIb polypeptide 1
Rat(502592) cytochrome c oxidase, subunit VIb polypeptide 1
Zebrafish(436968) cytochrome c oxidase subunit VIb polypeptide 1
cow(100270792) cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001863 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001863 Rosetta Predictions human pricing
XM_001071713 Rosetta Predictions rat pricing
XM_578078 Rosetta Predictions rat pricing
NM_025628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059576 predicted 310
2 SASI_Hs01_00059577 predicted 301
3 SASI_Hs01_00059578 predicted 220
4 SASI_Hs01_00059579 predicted 306
5 SASI_Hs01_00059580 predicted 314
6 SASI_Hs01_00059581 predicted 293
7 SASI_Hs01_00059582 predicted 301
8 SASI_Hs01_00059583 predicted 292
9 SASI_Hs01_00059584 predicted 292
10 SASI_Hs01_00059585 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336147 predicted 233
2 SASI_Rn02_00336148 predicted 198
3 SASI_Rn02_00336149 predicted 234
4 SASI_Rn02_00336150 predicted 249
5 SASI_Rn02_00336151 predicted 223
6 SASI_Rn02_00336152 predicted 249
7 SASI_Rn02_00336153 predicted 234
8 SASI_Rn02_00336154 predicted 247
9 SASI_Rn02_00336155 predicted 225
10 SASI_Rn02_00336156 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407531 predicted 228
2 SASI_Rn02_00407532 predicted 196
3 SASI_Rn02_00407533 predicted 233
4 SASI_Rn02_00407534 predicted 246
5 SASI_Rn02_00407535 predicted 226
6 SASI_Rn02_00407536 predicted 254
7 SASI_Rn02_00407537 predicted 228
8 SASI_Rn02_00407538 predicted 242
9 SASI_Rn02_00407539 predicted 227
10 SASI_Rn02_00407540 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025480 predicted 209
2 SASI_Mm01_00025481 predicted 268
3 SASI_Mm01_00025482 predicted 220
4 SASI_Mm01_00025483 predicted 266
5 SASI_Mm01_00025484 predicted 272
6 SASI_Mm01_00025485 predicted 194
7 SASI_Mm01_00025486 predicted 263
8 SASI_Mm01_00025487 predicted 217
9 SASI_Mm01_00025488 predicted 214
10 SASI_Mm01_00025489 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001863
VALIDATED
COX6B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-404s21c1
Sequence:CCGGCGTTTCCCGGGAAGATCTGAACTCGAGTTCAGATCTTCCCGGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-252s21c1
Sequence:CCGGCTGGCAGAACTACCTGGACTTCTCGAGAAGTCCAGGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001863.3-275s21c1
Sequence:CCGGACCGCTGTCAGAAGGCAATGACTCGAGTCATTGCCTTCTGACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-240s21c1
Sequence:CCGGGACTAGAAACTGCTGGCAGAACTCGAGTTCTGCCAGCAGTTTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-308s21c1
Sequence:CCGGGCGATATCTCTGTGTGCGAATCTCGAGATTCGCACACAGAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001863.3-252s1c1
Sequence:CCGGCTGGCAGAACTACCTGGACTTCTCGAGAAGTCCAGGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001863.3-294s1c1
Sequence:CCGGGACCGCTAAAGGAGGCGATATCTCGAGATATCGCCTCCTTTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001863.3-379s1c1
Sequence:CCGGTGGGATGAGCAACGGGCTGAACTCGAGTTCAGCCCGTTGCTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001863.3-227s1c1
Sequence:CCGGCCAACCAGAACCAGACTAGAACTCGAGTTCTAGTCTGGTTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001863.3-308s1c1
Sequence:CCGGGCGATATCTCTGTGTGCGAATCTCGAGATTCGCACACAGAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001863
VALIDATED
COX6B1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-404s21c1
Sequence:CCGGCGTTTCCCGGGAAGATCTGAACTCGAGTTCAGATCTTCCCGGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-252s21c1
Sequence:CCGGCTGGCAGAACTACCTGGACTTCTCGAGAAGTCCAGGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001863.3-275s21c1
Sequence:CCGGACCGCTGTCAGAAGGCAATGACTCGAGTCATTGCCTTCTGACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-240s21c1
Sequence:CCGGGACTAGAAACTGCTGGCAGAACTCGAGTTCTGCCAGCAGTTTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-308s21c1
Sequence:CCGGGCGATATCTCTGTGTGCGAATCTCGAGATTCGCACACAGAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001863.3-252s1c1
Sequence:CCGGCTGGCAGAACTACCTGGACTTCTCGAGAAGTCCAGGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001863.3-294s1c1
Sequence:CCGGGACCGCTAAAGGAGGCGATATCTCGAGATATCGCCTCCTTTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001863.3-379s1c1
Sequence:CCGGTGGGATGAGCAACGGGCTGAACTCGAGTTCAGCCCGTTGCTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001863.3-227s1c1
Sequence:CCGGCCAACCAGAACCAGACTAGAACTCGAGTTCTAGTCTGGTTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001863.3-308s1c1
Sequence:CCGGGCGATATCTCTGTGTGCGAATCTCGAGATTCGCACACAGAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001863
VALIDATED
COX6B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-404s21c1
Sequence:CCGGCGTTTCCCGGGAAGATCTGAACTCGAGTTCAGATCTTCCCGGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-252s21c1
Sequence:CCGGCTGGCAGAACTACCTGGACTTCTCGAGAAGTCCAGGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001863.3-275s21c1
Sequence:CCGGACCGCTGTCAGAAGGCAATGACTCGAGTCATTGCCTTCTGACAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-240s21c1
Sequence:CCGGGACTAGAAACTGCTGGCAGAACTCGAGTTCTGCCAGCAGTTTCTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001863.3-308s21c1
Sequence:CCGGGCGATATCTCTGTGTGCGAATCTCGAGATTCGCACACAGAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001863.3-252s1c1
Sequence:CCGGCTGGCAGAACTACCTGGACTTCTCGAGAAGTCCAGGTAGTTCTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_001863.3-294s1c1
Sequence:CCGGGACCGCTAAAGGAGGCGATATCTCGAGATATCGCCTCCTTTAGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001863.3-379s1c1
Sequence:CCGGTGGGATGAGCAACGGGCTGAACTCGAGTTCAGCCCGTTGCTCATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001863.3-227s1c1
Sequence:CCGGCCAACCAGAACCAGACTAGAACTCGAGTTCTAGTCTGGTTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001863.3-308s1c1
Sequence:CCGGGCGATATCTCTGTGTGCGAATCTCGAGATTCGCACACAGAGATATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025628
VALIDATED
COX6B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-336s1c1
Sequence:CCGGCGCATAGCTGAAGGCACATTTCTCGAGAAATGTGCCTTCAGCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-185s1c1
Sequence:CCGGCCAGACTAAGAACTGTTGGCACTCGAGTGCCAACAGTTCTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-324s1c1
Sequence:CCGGGCCTGGGATGACCGCATAGCTCTCGAGAGCTATGCGGTCATCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-220s1c1
Sequence:CCGGTCCACCGCTGTGAGAAGGCAACTCGAGTTGCCTTCTCACAGCGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-181s1c1
Sequence:CCGGAGAACCAGACTAAGAACTGTTCTCGAGAACAGTTCTTAGTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025628
VALIDATED
COX6B1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-336s1c1
Sequence:CCGGCGCATAGCTGAAGGCACATTTCTCGAGAAATGTGCCTTCAGCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-185s1c1
Sequence:CCGGCCAGACTAAGAACTGTTGGCACTCGAGTGCCAACAGTTCTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-324s1c1
Sequence:CCGGGCCTGGGATGACCGCATAGCTCTCGAGAGCTATGCGGTCATCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-220s1c1
Sequence:CCGGTCCACCGCTGTGAGAAGGCAACTCGAGTTGCCTTCTCACAGCGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-181s1c1
Sequence:CCGGAGAACCAGACTAAGAACTGTTCTCGAGAACAGTTCTTAGTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025628
VALIDATED
COX6B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIb polypeptide 1 (ubiquitous)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-336s1c1
Sequence:CCGGCGCATAGCTGAAGGCACATTTCTCGAGAAATGTGCCTTCAGCTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-185s1c1
Sequence:CCGGCCAGACTAAGAACTGTTGGCACTCGAGTGCCAACAGTTCTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-324s1c1
Sequence:CCGGGCCTGGGATGACCGCATAGCTCTCGAGAGCTATGCGGTCATCCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-220s1c1
Sequence:CCGGTCCACCGCTGTGAGAAGGCAACTCGAGTTGCCTTCTCACAGCGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025628.1-181s1c1
Sequence:CCGGAGAACCAGACTAAGAACTGTTCTCGAGAACAGTTCTTAGTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks