EMAIL THIS PAGE TO A FRIEND

COX6C

cytochrome c oxidase subunit VIc

72 Gene Product Result for
UniProtKB ID: P09669, B2R4D7
Gene ID:
Human(1345) Summary: Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010]
Mouse(12864) cytochrome c oxidase subunit VIc
Rat(54322) cytochrome c oxidase, subunit VIc
Zebrafish(494577) cytochrome c oxidase subunit VIc
cow(782486) cytochrome c oxidase subunit VIc
chicken(420243) cytochrome c oxidase subunit VIc
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004374 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004374 Rosetta Predictions human pricing
NM_019360 Rosetta Predictions rat pricing
NM_053071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196910 predicted 271
2 SASI_Hs02_00337451 predicted 263
3 SASI_Hs02_00337452 predicted 262
4 SASI_Hs02_00337453 predicted 127
5 SASI_Hs02_00337454 predicted 172
6 SASI_Hs02_00337455 predicted 128
7 SASI_Hs01_00196908 predicted 334
8 SASI_Hs01_00196909 predicted 379
9 SASI_Hs02_00337456 predicted 329
10 SASI_Hs02_00337457 predicted 213
11 SASI_Hs01_00196901 predicted 203
12 SASI_Hs01_00196902 predicted 211
13 SASI_Hs01_00196903 predicted 203
14 SASI_Hs01_00196904 predicted 203
15 SASI_Hs01_00196905 predicted 207
16 SASI_Hs01_00196906 predicted 202
17 SASI_Hs01_00196907 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262372 predicted 206
2 SASI_Rn02_00262373 predicted 196
3 SASI_Rn02_00262374 predicted 203
4 SASI_Rn02_00262375 predicted 192
5 SASI_Rn02_00262376 predicted 199
6 SASI_Rn02_00262377 predicted 368
7 SASI_Rn01_00093135 predicted 327
8 SASI_Rn02_00262378 predicted 160
9 SASI_Rn02_00262379 predicted 89
10 SASI_Rn02_00262380 predicted 307
11 SASI_Rn01_00093134 predicted 268
12 SASI_Rn01_00093136 predicted 292
13 SASI_Rn01_00093137 predicted 224
14 SASI_Rn01_00093138 predicted 272
15 SASI_Rn01_00093139 predicted 337
16 SASI_Rn01_00093140 predicted 227
17 SASI_Rn01_00093141 predicted 338
18 SASI_Rn01_00093142 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337529 predicted 271
2 SASI_Mm02_00337530 predicted 222
3 SASI_Mm02_00337531 predicted 281
4 SASI_Mm02_00337532 predicted 269
5 SASI_Mm02_00337533 predicted 229
6 SASI_Mm02_00337534 predicted 270
7 SASI_Mm02_00337535 predicted 274
8 SASI_Mm02_00337536 predicted 205
9 SASI_Mm02_00337537 predicted 273
10 SASI_Mm02_00337538 predicted 232
11 SASI_Mm01_00143684 predicted 197
12 SASI_Mm01_00143685 predicted 456
13 SASI_Mm01_00143686 predicted 193
14 SASI_Mm01_00143687 predicted 431
15 SASI_Mm01_00143688 predicted 467
16 SASI_Mm01_00143689 predicted 357
17 SASI_Mm01_00143690 predicted 385
18 SASI_Mm01_00143691 predicted 450
19 SASI_Mm01_00143692 predicted 464
20 SASI_Mm01_00143693 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053071
VALIDATED
COX6C MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIc
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-312s21c1
Sequence:CCGGCATGAAAGATTTCGAAGAGATCTCGAGATCTCTTCGAAATCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-235s21c1
Sequence:CCGGGTTGCCGCTGCCTATAAGTTTCTCGAGAAACTTATAGGCAGCGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-281s21c1
Sequence:CCGGCGTATGCAGAATTCTACAGAACTCGAGTTCTGTAGAATTCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053071.1-229s1c2
Sequence:CCGGCATGAAAGATTTCGAAGAGATCTCGAGATCTCTTCGAAATCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053071.1-113s1c2
Sequence:CCGGCGGGTTCATATTGCTGGCGCACTCGAGTGCGCCAGCAATATGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-341s21c1
Sequence:CCGGCTGGTATCTTTCAGAGTGCCACTCGAGTGGCACTCTGAAAGATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-198s1c1
Sequence:CCGGCGTATGCAGAATTCTACAGAACTCGAGTTCTGTAGAATTCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-258s1c1
Sequence:CCGGCTGGTATCTTTCAGAGTGCCACTCGAGTGGCACTCTGAAAGATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-152s1c1
Sequence:CCGGGTTGCCGCTGCCTATAAGTTTCTCGAGAAACTTATAGGCAGCGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053071
VALIDATED
COX6C MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIc
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-312s21c1
Sequence:CCGGCATGAAAGATTTCGAAGAGATCTCGAGATCTCTTCGAAATCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-235s21c1
Sequence:CCGGGTTGCCGCTGCCTATAAGTTTCTCGAGAAACTTATAGGCAGCGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-281s21c1
Sequence:CCGGCGTATGCAGAATTCTACAGAACTCGAGTTCTGTAGAATTCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053071.1-229s1c2
Sequence:CCGGCATGAAAGATTTCGAAGAGATCTCGAGATCTCTTCGAAATCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053071.1-113s1c2
Sequence:CCGGCGGGTTCATATTGCTGGCGCACTCGAGTGCGCCAGCAATATGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-341s21c1
Sequence:CCGGCTGGTATCTTTCAGAGTGCCACTCGAGTGGCACTCTGAAAGATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-198s1c1
Sequence:CCGGCGTATGCAGAATTCTACAGAACTCGAGTTCTGTAGAATTCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-258s1c1
Sequence:CCGGCTGGTATCTTTCAGAGTGCCACTCGAGTGGCACTCTGAAAGATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-152s1c1
Sequence:CCGGGTTGCCGCTGCCTATAAGTTTCTCGAGAAACTTATAGGCAGCGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053071
VALIDATED
COX6C MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIc
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-312s21c1
Sequence:CCGGCATGAAAGATTTCGAAGAGATCTCGAGATCTCTTCGAAATCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-235s21c1
Sequence:CCGGGTTGCCGCTGCCTATAAGTTTCTCGAGAAACTTATAGGCAGCGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-281s21c1
Sequence:CCGGCGTATGCAGAATTCTACAGAACTCGAGTTCTGTAGAATTCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053071.1-229s1c2
Sequence:CCGGCATGAAAGATTTCGAAGAGATCTCGAGATCTCTTCGAAATCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053071.1-113s1c2
Sequence:CCGGCGGGTTCATATTGCTGGCGCACTCGAGTGCGCCAGCAATATGAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053071.2-341s21c1
Sequence:CCGGCTGGTATCTTTCAGAGTGCCACTCGAGTGGCACTCTGAAAGATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-198s1c1
Sequence:CCGGCGTATGCAGAATTCTACAGAACTCGAGTTCTGTAGAATTCTGCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-258s1c1
Sequence:CCGGCTGGTATCTTTCAGAGTGCCACTCGAGTGGCACTCTGAAAGATACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053071.1-152s1c1
Sequence:CCGGGTTGCCGCTGCCTATAAGTTTCTCGAGAAACTTATAGGCAGCGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004374
VALIDATED
COX6C MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIc
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-174s21c1
Sequence:CCGGGTTTCGTGTGGCTGATCAAAGCTCGAGCTTTGATCAGCCACACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-273s21c1
Sequence:CCGGTCAGAGTGTAAAGTAATCTTGCTCGAGCAAGATTACTTTACACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004374.2-262s21c1
Sequence:CCGGGCTGGTATCTTTCAGAGTGTACTCGAGTACACTCTGAAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-194s21c1
Sequence:CCGGGAAAGAAGGCATACGCAGATTCTCGAGAATCTGCGTATGCCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004374.2-106s21c1
Sequence:CCGGGCCAGGCGTCTGCGAAATCATCTCGAGATGATTTCGCAGACGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-262s1c1
Sequence:CCGGGCTGGTATCTTTCAGAGTGTACTCGAGTACACTCTGAAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-216s1c1
Sequence:CCGGCTACAGAAACTACGATGTCATCTCGAGATGACATCGTAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-160s1c1
Sequence:CCGGGCAGCTTTGTATAAGTTTCGTCTCGAGACGAAACTTATACAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-106s1c1
Sequence:CCGGGCCAGGCGTCTGCGAAATCATCTCGAGATGATTTCGCAGACGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-115s1c1
Sequence:CCGGCTGCGAAATCATATGGCTGTACTCGAGTACAGCCATATGATTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004374
VALIDATED
COX6C MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIc
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-174s21c1
Sequence:CCGGGTTTCGTGTGGCTGATCAAAGCTCGAGCTTTGATCAGCCACACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-273s21c1
Sequence:CCGGTCAGAGTGTAAAGTAATCTTGCTCGAGCAAGATTACTTTACACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004374.2-262s21c1
Sequence:CCGGGCTGGTATCTTTCAGAGTGTACTCGAGTACACTCTGAAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-194s21c1
Sequence:CCGGGAAAGAAGGCATACGCAGATTCTCGAGAATCTGCGTATGCCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004374.2-106s21c1
Sequence:CCGGGCCAGGCGTCTGCGAAATCATCTCGAGATGATTTCGCAGACGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-262s1c1
Sequence:CCGGGCTGGTATCTTTCAGAGTGTACTCGAGTACACTCTGAAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-216s1c1
Sequence:CCGGCTACAGAAACTACGATGTCATCTCGAGATGACATCGTAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-160s1c1
Sequence:CCGGGCAGCTTTGTATAAGTTTCGTCTCGAGACGAAACTTATACAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-106s1c1
Sequence:CCGGGCCAGGCGTCTGCGAAATCATCTCGAGATGATTTCGCAGACGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-115s1c1
Sequence:CCGGCTGCGAAATCATATGGCTGTACTCGAGTACAGCCATATGATTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004374
VALIDATED
COX6C MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIc
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-174s21c1
Sequence:CCGGGTTTCGTGTGGCTGATCAAAGCTCGAGCTTTGATCAGCCACACGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-273s21c1
Sequence:CCGGTCAGAGTGTAAAGTAATCTTGCTCGAGCAAGATTACTTTACACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004374.2-262s21c1
Sequence:CCGGGCTGGTATCTTTCAGAGTGTACTCGAGTACACTCTGAAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004374.2-194s21c1
Sequence:CCGGGAAAGAAGGCATACGCAGATTCTCGAGAATCTGCGTATGCCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004374.2-106s21c1
Sequence:CCGGGCCAGGCGTCTGCGAAATCATCTCGAGATGATTTCGCAGACGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-262s1c1
Sequence:CCGGGCTGGTATCTTTCAGAGTGTACTCGAGTACACTCTGAAAGATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-216s1c1
Sequence:CCGGCTACAGAAACTACGATGTCATCTCGAGATGACATCGTAGTTTCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-160s1c1
Sequence:CCGGGCAGCTTTGTATAAGTTTCGTCTCGAGACGAAACTTATACAAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-106s1c1
Sequence:CCGGGCCAGGCGTCTGCGAAATCATCTCGAGATGATTTCGCAGACGCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_004374.2-115s1c1
Sequence:CCGGCTGCGAAATCATATGGCTGTACTCGAGTACAGCCATATGATTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks