EMAIL THIS PAGE TO A FRIEND

COX7A1

cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)

28 Gene Product Result for
Synonyms: COX7A COX7AH COX7AM
UniProtKB ID: P24310
Gene ID:
Human(1346) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (muscle isoform) of subunit VIIa and the polypeptide 1 is present only in muscle tissues. Other polypeptides of subunit VIIa are present in both muscle and nonmuscle tissues, and are encoded by different genes. [provided by RefSeq, Jul 2008]
Mouse(12865) cytochrome c oxidase subunit VIIa 1
Zebrafish(767664) cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
cow(338086) cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
dog(612614) cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302719 ANTI-COX7A1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194821 MISSION® esiRNA esiRNA targeting mouse Cox7a1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001864 Rosetta Predictions human pricing
NM_009944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103227 predicted 540
2 SASI_Hs01_00103228 predicted 537
3 SASI_Hs01_00103229 predicted 718
4 SASI_Hs01_00103230 predicted 712
5 SASI_Hs02_00332697 predicted 510
6 SASI_Hs01_00103231 predicted 634
7 SASI_Hs01_00103233 predicted 510
8 SASI_Hs01_00103234 predicted 640
9 SASI_Hs01_00103235 predicted 723
10 SASI_Hs01_00103236 predicted 729
11 SASI_Hs01_00103232 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030943 predicted 153
2 SASI_Mm02_00317503 predicted 316
3 SASI_Mm01_00030944 predicted 197
4 SASI_Mm01_00030945 predicted 304
5 SASI_Mm01_00030946 predicted 159
6 SASI_Mm01_00030947 predicted 296
7 SASI_Mm01_00030948 predicted 286
8 SASI_Mm01_00030949 predicted 245
9 SASI_Mm01_00030950 predicted 78
10 SASI_Mm01_00030951 predicted 152
11 SASI_Mm01_00030952 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001864
COX7A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-611s1c1
Sequence:CCGGACATCCTGTACCGAGTGACAACTCGAGTTGTCACTCGGTACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-600s1c1
Sequence:CCGGCATCGTTGACAACATCCTGTACTCGAGTACAGGATGTTGTCAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-622s1c1
Sequence:CCGGCGAGTGACAATGACGCTGTGTCTCGAGACACAGCGTCATTGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-529s1c1
Sequence:CCGGCAGAACCGAGTGCGCGAGAAACTCGAGTTTCTCGCGCACTCGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-570s1c1
Sequence:CCGGCAATGACATCCCGTTGTACCTCTCGAGAGGTACAACGGGATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-554s21c1
Sequence:CCGGAGCTCTTCCAGGAGGACAATGCTCGAGCATTGTCCTCCTGGAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-649s21c1
Sequence:CCGGGGCACTGTCTACAGCTTGTACCTCGAGGTACAAGCTGTAGACAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-518s21c1
Sequence:CCGGGGAACCGCTTTCAGAACCGAGCTCGAGCTCGGTTCTGAAAGCGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001864
COX7A1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-611s1c1
Sequence:CCGGACATCCTGTACCGAGTGACAACTCGAGTTGTCACTCGGTACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-600s1c1
Sequence:CCGGCATCGTTGACAACATCCTGTACTCGAGTACAGGATGTTGTCAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-622s1c1
Sequence:CCGGCGAGTGACAATGACGCTGTGTCTCGAGACACAGCGTCATTGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-529s1c1
Sequence:CCGGCAGAACCGAGTGCGCGAGAAACTCGAGTTTCTCGCGCACTCGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-570s1c1
Sequence:CCGGCAATGACATCCCGTTGTACCTCTCGAGAGGTACAACGGGATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-554s21c1
Sequence:CCGGAGCTCTTCCAGGAGGACAATGCTCGAGCATTGTCCTCCTGGAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-649s21c1
Sequence:CCGGGGCACTGTCTACAGCTTGTACCTCGAGGTACAAGCTGTAGACAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-518s21c1
Sequence:CCGGGGAACCGCTTTCAGAACCGAGCTCGAGCTCGGTTCTGAAAGCGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001864
COX7A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-611s1c1
Sequence:CCGGACATCCTGTACCGAGTGACAACTCGAGTTGTCACTCGGTACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-600s1c1
Sequence:CCGGCATCGTTGACAACATCCTGTACTCGAGTACAGGATGTTGTCAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-622s1c1
Sequence:CCGGCGAGTGACAATGACGCTGTGTCTCGAGACACAGCGTCATTGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-529s1c1
Sequence:CCGGCAGAACCGAGTGCGCGAGAAACTCGAGTTTCTCGCGCACTCGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001864.2-570s1c1
Sequence:CCGGCAATGACATCCCGTTGTACCTCTCGAGAGGTACAACGGGATGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-554s21c1
Sequence:CCGGAGCTCTTCCAGGAGGACAATGCTCGAGCATTGTCCTCCTGGAAGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-649s21c1
Sequence:CCGGGGCACTGTCTACAGCTTGTACCTCGAGGTACAAGCTGTAGACAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001864.2-518s21c1
Sequence:CCGGGGAACCGCTTTCAGAACCGAGCTCGAGCTCGGTTCTGAAAGCGGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009944
COX7A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-126s1c1
Sequence:CCGGGCCGACAATGACCTCCCAGTACTCGAGTACTGGGAGGTCATTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-73s1c1
Sequence:CCGGCTACCAGAAGCCACTTAGAAACTCGAGTTTCTAAGTGGCTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-163s1c1
Sequence:CCGGGAATGGACAACGTCCTGTACACTCGAGTGTACAGGACGTTGTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-67s1c1
Sequence:CCGGGCTCATCTACCAGAAGCCACTCTCGAGAGTGGCTTCTGGTAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-135s1c1
Sequence:CCGGGACCTCCCAGTACACTTGAAACTCGAGTTTCAAGTGTACTGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009944
COX7A1 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-126s1c1
Sequence:CCGGGCCGACAATGACCTCCCAGTACTCGAGTACTGGGAGGTCATTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-73s1c1
Sequence:CCGGCTACCAGAAGCCACTTAGAAACTCGAGTTTCTAAGTGGCTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-163s1c1
Sequence:CCGGGAATGGACAACGTCCTGTACACTCGAGTGTACAGGACGTTGTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-67s1c1
Sequence:CCGGGCTCATCTACCAGAAGCCACTCTCGAGAGTGGCTTCTGGTAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-135s1c1
Sequence:CCGGGACCTCCCAGTACACTTGAAACTCGAGTTTCAAGTGTACTGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009944
COX7A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 1 (muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-126s1c1
Sequence:CCGGGCCGACAATGACCTCCCAGTACTCGAGTACTGGGAGGTCATTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-73s1c1
Sequence:CCGGCTACCAGAAGCCACTTAGAAACTCGAGTTTCTAAGTGGCTTCTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-163s1c1
Sequence:CCGGGAATGGACAACGTCCTGTACACTCGAGTGTACAGGACGTTGTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-67s1c1
Sequence:CCGGGCTCATCTACCAGAAGCCACTCTCGAGAGTGGCTTCTGGTAGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009944.2-135s1c1
Sequence:CCGGGACCTCCCAGTACACTTGAAACTCGAGTTTCAAGTGTACTGGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks