EMAIL THIS PAGE TO A FRIEND

COX7A2

cytochrome c oxidase subunit VIIa polypeptide 2 (liver)

51 Gene Product Result for
Synonyms: COX7AL COX7AL1 COXVIIAL COXVIIa-L VIIAL
UniProtKB ID: P14406, B2R5E1, Q3MIH5, Q5TF59, Q6FGI2
Gene ID:
Human(1347) Summary: Cytochrome c oxidase, the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of three catalytic subunits encoded by mitochondrial genes, and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, while the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (liver isoform) of subunit VIIa, with this polypeptide being present in both muscle and non-muscle tissues. In addition to polypeptide 2, subunit VIIa includes polypeptide 1 (muscle isoform), which is present only in muscle tissues, and a related protein, which is present in all tissues. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4 and 14. [provided by RefSeq, Oct 2009]
Mouse(12866) cytochrome c oxidase subunit VIIa 2
Rat(29507) cytochrome c oxidase subunit VIIa polypeptide 2
chicken(772260) cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
cow(327688) cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500421 Anti-COX7S, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300905 Anti-COX7S/A2 antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001865 Rosetta Predictions human pricing
NM_022503 Rosetta Predictions rat pricing
NM_009945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118646 predicted 243
2 SASI_Hs01_00118647 predicted 231
3 SASI_Hs01_00118648 predicted 216
4 SASI_Hs01_00118649 predicted 239
5 SASI_Hs01_00118650 predicted 212
6 SASI_Hs01_00118651 predicted 239
7 SASI_Hs01_00118652 predicted 216
8 SASI_Hs01_00118653 predicted 231
9 SASI_Hs01_00118654 predicted 215
10 SASI_Hs02_00332698 predicted 332
11 SASI_Hs01_00118655 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263211 predicted 199
2 SASI_Rn02_00263212 predicted 224
3 SASI_Rn01_00121048 predicted 225
4 SASI_Rn01_00121049 predicted 251
5 SASI_Rn01_00121050 predicted 231
6 SASI_Rn01_00121051 predicted 223
7 SASI_Rn01_00121052 predicted 237
8 SASI_Rn02_00263213 predicted 209
9 SASI_Rn01_00121053 predicted 231
10 SASI_Rn01_00121054 predicted 256
11 SASI_Rn01_00121055 predicted 203
12 SASI_Rn01_00121056 predicted 226
13 SASI_Rn01_00121057 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317504 predicted 242
2 SASI_Mm02_00317505 predicted 223
3 SASI_Mm01_00090372 predicted 391
4 SASI_Mm02_00317506 predicted 441
5 SASI_Mm01_00090373 predicted 389
6 SASI_Mm01_00090374 predicted 467
7 SASI_Mm01_00090375 predicted 365
8 SASI_Mm01_00090377 predicted 394
9 SASI_Mm01_00090378 predicted 394
10 SASI_Mm01_00090379 predicted 444
11 SASI_Mm01_00090376 predicted 531
12 SASI_Mm01_00090380 predicted 402
13 SASI_Mm01_00090381 predicted 296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009945
VALIDATED
COX7A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009945.3-467s21c1
Sequence:CCGGCACGTGGTTCAGTTTCATCAACTCGAGTTGATGAAACTGAACCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-427s21c1
Sequence:CCGGATTTCCCAAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-305s21c1
Sequence:CCGGGAGGATAATGGGATGCCAGTTCTCGAGAACTGGCATCCCATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-246s21c1
Sequence:CCGGGCACCACTTCACGAAGGCATTCTCGAGAATGCCTTCGTGAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-344s1c1
Sequence:CCGGCACGTGGTTCAGTTTCATCAACTCGAGTTGATGAAACTGAACCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-287s1c1
Sequence:CCGGCTGTTAGCTATGGCTGCATTTCTCGAGAAATGCAGCCATAGCTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-182s1c1
Sequence:CCGGGAGGATAATGGGATGCCAGTTCTCGAGAACTGGCATCCCATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-123s1c1
Sequence:CCGGGCACCACTTCACGAAGGCATTCTCGAGAATGCCTTCGTGAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-304s1c1
Sequence:CCGGATTTCCCAAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009945
VALIDATED
COX7A2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009945.3-467s21c1
Sequence:CCGGCACGTGGTTCAGTTTCATCAACTCGAGTTGATGAAACTGAACCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-427s21c1
Sequence:CCGGATTTCCCAAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-305s21c1
Sequence:CCGGGAGGATAATGGGATGCCAGTTCTCGAGAACTGGCATCCCATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-246s21c1
Sequence:CCGGGCACCACTTCACGAAGGCATTCTCGAGAATGCCTTCGTGAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-344s1c1
Sequence:CCGGCACGTGGTTCAGTTTCATCAACTCGAGTTGATGAAACTGAACCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-287s1c1
Sequence:CCGGCTGTTAGCTATGGCTGCATTTCTCGAGAAATGCAGCCATAGCTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-182s1c1
Sequence:CCGGGAGGATAATGGGATGCCAGTTCTCGAGAACTGGCATCCCATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-123s1c1
Sequence:CCGGGCACCACTTCACGAAGGCATTCTCGAGAATGCCTTCGTGAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-304s1c1
Sequence:CCGGATTTCCCAAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009945
VALIDATED
COX7A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009945.3-467s21c1
Sequence:CCGGCACGTGGTTCAGTTTCATCAACTCGAGTTGATGAAACTGAACCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-427s21c1
Sequence:CCGGATTTCCCAAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-305s21c1
Sequence:CCGGGAGGATAATGGGATGCCAGTTCTCGAGAACTGGCATCCCATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009945.3-246s21c1
Sequence:CCGGGCACCACTTCACGAAGGCATTCTCGAGAATGCCTTCGTGAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-344s1c1
Sequence:CCGGCACGTGGTTCAGTTTCATCAACTCGAGTTGATGAAACTGAACCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-287s1c1
Sequence:CCGGCTGTTAGCTATGGCTGCATTTCTCGAGAAATGCAGCCATAGCTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-182s1c1
Sequence:CCGGGAGGATAATGGGATGCCAGTTCTCGAGAACTGGCATCCCATTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-123s1c1
Sequence:CCGGGCACCACTTCACGAAGGCATTCTCGAGAATGCCTTCGTGAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009945.2-304s1c1
Sequence:CCGGATTTCCCAAGAAGCAGAACTACTCGAGTAGTTCTGCTTCTTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001865
VALIDATED
COX7A2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-104s21c1
Sequence:CCGGAGATTGGGCAGAGGACGATAACTCGAGTTATCGTCCTCTGCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001865.2-177s21c1
Sequence:CCGGGTTCCAGGAGGATGATGAAATCTCGAGATTTCATCATCCTCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-244s21c1
Sequence:CCGGGCCACCATGATTCTTACAGTTCTCGAGAACTGTAAGAATCATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-126s21c1
Sequence:CCGGCACTGCTTCCCGCAGGCATTTCTCGAGAAATGCCTGCGGGAAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-221s21c1
Sequence:CCGGTAGCTGATGCCCTCCTGTATACTCGAGTATACAGGAGGGCATCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001865.2-305s1c1
Sequence:CCGGCATTTCCCAAGAAGCAGGAGTCTCGAGACTCCTGCTTCTTGGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001865.2-297s1c1
Sequence:CCGGTGTGGCTTCATTTCCCAAGAACTCGAGTTCTTGGGAAATGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_001865.2-113s1c1
Sequence:CCGGAGAGGACGATAAGCACTGCTTCTCGAGAAGCAGTGCTTATCGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001865.2-235s1c1
Sequence:CCGGCTGTATAGAGCCACCATGATTCTCGAGAATCATGGTGGCTCTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001865.2-187s1c1
Sequence:CCGGGATGATGAAATTCCACTGTATCTCGAGATACAGTGGAATTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001865
VALIDATED
COX7A2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-104s21c1
Sequence:CCGGAGATTGGGCAGAGGACGATAACTCGAGTTATCGTCCTCTGCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001865.2-177s21c1
Sequence:CCGGGTTCCAGGAGGATGATGAAATCTCGAGATTTCATCATCCTCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-244s21c1
Sequence:CCGGGCCACCATGATTCTTACAGTTCTCGAGAACTGTAAGAATCATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-126s21c1
Sequence:CCGGCACTGCTTCCCGCAGGCATTTCTCGAGAAATGCCTGCGGGAAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-221s21c1
Sequence:CCGGTAGCTGATGCCCTCCTGTATACTCGAGTATACAGGAGGGCATCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001865.2-305s1c1
Sequence:CCGGCATTTCCCAAGAAGCAGGAGTCTCGAGACTCCTGCTTCTTGGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001865.2-297s1c1
Sequence:CCGGTGTGGCTTCATTTCCCAAGAACTCGAGTTCTTGGGAAATGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_001865.2-113s1c1
Sequence:CCGGAGAGGACGATAAGCACTGCTTCTCGAGAAGCAGTGCTTATCGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001865.2-235s1c1
Sequence:CCGGCTGTATAGAGCCACCATGATTCTCGAGAATCATGGTGGCTCTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001865.2-187s1c1
Sequence:CCGGGATGATGAAATTCCACTGTATCTCGAGATACAGTGGAATTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001865
VALIDATED
COX7A2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIa polypeptide 2 (liver)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-104s21c1
Sequence:CCGGAGATTGGGCAGAGGACGATAACTCGAGTTATCGTCCTCTGCCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001865.2-177s21c1
Sequence:CCGGGTTCCAGGAGGATGATGAAATCTCGAGATTTCATCATCCTCCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-244s21c1
Sequence:CCGGGCCACCATGATTCTTACAGTTCTCGAGAACTGTAAGAATCATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-126s21c1
Sequence:CCGGCACTGCTTCCCGCAGGCATTTCTCGAGAAATGCCTGCGGGAAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001865.2-221s21c1
Sequence:CCGGTAGCTGATGCCCTCCTGTATACTCGAGTATACAGGAGGGCATCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001865.2-305s1c1
Sequence:CCGGCATTTCCCAAGAAGCAGGAGTCTCGAGACTCCTGCTTCTTGGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001865.2-297s1c1
Sequence:CCGGTGTGGCTTCATTTCCCAAGAACTCGAGTTCTTGGGAAATGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_001865.2-113s1c1
Sequence:CCGGAGAGGACGATAAGCACTGCTTCTCGAGAAGCAGTGCTTATCGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001865.2-235s1c1
Sequence:CCGGCTGTATAGAGCCACCATGATTCTCGAGAATCATGGTGGCTCTATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_001865.2-187s1c1
Sequence:CCGGGATGATGAAATTCCACTGTATCTCGAGATACAGTGGAATTTCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks