EMAIL THIS PAGE TO A FRIEND

COX7B2

cytochrome c oxidase subunit VIIb2

44 Gene Product Result for
UniProtKB ID: Q8TF08, Q32Q40
Gene ID:
Mouse(78174) cytochrome c oxidase subunit VIIb2
Rat(100361960) cytochrome c oxidase subunit VIIb2
cow(767916) cytochrome c oxidase subunit 7B2, mitochondrial
dog(100687434) cytochrome c oxidase subunit VIIb2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700079 Anti-COX7B2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300953 Anti-COX7B2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125361 MISSION® esiRNA esiRNA human COX7B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130902 Rosetta Predictions human pricing
NM_030052 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362914 predicted 316
2 SASI_Hs02_00362915 predicted 201
3 SASI_Hs01_00112728 predicted 247
4 SASI_Hs01_00112729 predicted 240
5 SASI_Hs02_00362916 predicted 239
6 SASI_Hs02_00362917 predicted 200
7 SASI_Hs01_00112732 predicted 239
8 SASI_Hs01_00112733 predicted 308
9 SASI_Hs02_00362918 predicted 201
10 SASI_Hs01_00112724 predicted 293
11 SASI_Hs01_00112725 predicted 231
12 SASI_Hs01_00112726 predicted 306
13 SASI_Hs01_00112727 predicted 391
14 SASI_Hs01_00112730 predicted 306
15 SASI_Hs01_00112731 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021224 predicted 165
2 SASI_Mm01_00021225 predicted 392
3 SASI_Mm01_00021226 predicted 156
4 SASI_Mm01_00021227 predicted 188
5 SASI_Mm01_00021228 predicted 240
6 SASI_Mm01_00021229 predicted 386
7 SASI_Mm01_00021230 predicted 261
8 SASI_Mm01_00021231 predicted 210
9 SASI_Mm01_00021232 predicted 304
10 SASI_Mm01_00021233 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130902
COX7B2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIb2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-285s21c1
Sequence:CCGGTGATAAATATGGTAATGCTGTCTCGAGACAGCATTACCATATTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-246s21c1
Sequence:CCGGGGCAAGACATAGCCATGTAAACTCGAGTTTACATGGCTATGTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-364s21c1
Sequence:CCGGGGAATAGAATGGAACCTATCCCTCGAGGGATAGGTTCCATTCTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-301s1c1
Sequence:CCGGCCACTCAGATTGGAATAGAATCTCGAGATTCTATTCCAATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-183s1c1
Sequence:CCGGCTGCAAAGCATGGCAAGACATCTCGAGATGTCTTGCCATGCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-275s1c1
Sequence:CCGGCTGTGTTGCTACATGGGTGTTCTCGAGAACACCCATGTAGCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-268s1c1
Sequence:CCGGCTGCTTTCTGTGTTGCTACATCTCGAGATGTAGCAACACAGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-162s1c1
Sequence:CCGGAGTCTCAAGATTCAAAGCATTCTCGAGAATGCTTTGAATCTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130902
COX7B2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIb2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-285s21c1
Sequence:CCGGTGATAAATATGGTAATGCTGTCTCGAGACAGCATTACCATATTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-246s21c1
Sequence:CCGGGGCAAGACATAGCCATGTAAACTCGAGTTTACATGGCTATGTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-364s21c1
Sequence:CCGGGGAATAGAATGGAACCTATCCCTCGAGGGATAGGTTCCATTCTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-301s1c1
Sequence:CCGGCCACTCAGATTGGAATAGAATCTCGAGATTCTATTCCAATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-183s1c1
Sequence:CCGGCTGCAAAGCATGGCAAGACATCTCGAGATGTCTTGCCATGCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-275s1c1
Sequence:CCGGCTGTGTTGCTACATGGGTGTTCTCGAGAACACCCATGTAGCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-268s1c1
Sequence:CCGGCTGCTTTCTGTGTTGCTACATCTCGAGATGTAGCAACACAGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-162s1c1
Sequence:CCGGAGTCTCAAGATTCAAAGCATTCTCGAGAATGCTTTGAATCTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130902
COX7B2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIb2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-285s21c1
Sequence:CCGGTGATAAATATGGTAATGCTGTCTCGAGACAGCATTACCATATTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-246s21c1
Sequence:CCGGGGCAAGACATAGCCATGTAAACTCGAGTTTACATGGCTATGTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130902.2-364s21c1
Sequence:CCGGGGAATAGAATGGAACCTATCCCTCGAGGGATAGGTTCCATTCTATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-301s1c1
Sequence:CCGGCCACTCAGATTGGAATAGAATCTCGAGATTCTATTCCAATCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-183s1c1
Sequence:CCGGCTGCAAAGCATGGCAAGACATCTCGAGATGTCTTGCCATGCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-275s1c1
Sequence:CCGGCTGTGTTGCTACATGGGTGTTCTCGAGAACACCCATGTAGCAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-268s1c1
Sequence:CCGGCTGCTTTCTGTGTTGCTACATCTCGAGATGTAGCAACACAGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130902.1-162s1c1
Sequence:CCGGAGTCTCAAGATTCAAAGCATTCTCGAGAATGCTTTGAATCTTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030052
COX7B2 MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIb2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000193035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-279s1c1
Sequence:CCGGGATGCTAATTAGTGGGACTATCTCGAGATAGTCCCACTAATTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-224s1c1
Sequence:CCGGGACTGAAACACTCAAAGCCCTCTCGAGAGGGCTTTGAGTGTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-240s1c1
Sequence:CCGGGCCCTCATCAGAAGAAACTCACTCGAGTGAGTTTCTTCTGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-192s1c1
Sequence:CCGGCAAGACTCCAAGCATTCTGAACTCGAGTTCAGAATGCTTGGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030052
COX7B2 MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIb2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000193035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-279s1c1
Sequence:CCGGGATGCTAATTAGTGGGACTATCTCGAGATAGTCCCACTAATTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-224s1c1
Sequence:CCGGGACTGAAACACTCAAAGCCCTCTCGAGAGGGCTTTGAGTGTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-240s1c1
Sequence:CCGGGCCCTCATCAGAAGAAACTCACTCGAGTGAGTTTCTTCTGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-192s1c1
Sequence:CCGGCAAGACTCCAAGCATTCTGAACTCGAGTTCAGAATGCTTGGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030052
COX7B2 MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIb2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000193035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-279s1c1
Sequence:CCGGGATGCTAATTAGTGGGACTATCTCGAGATAGTCCCACTAATTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-224s1c1
Sequence:CCGGGACTGAAACACTCAAAGCCCTCTCGAGAGGGCTTTGAGTGTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-240s1c1
Sequence:CCGGGCCCTCATCAGAAGAAACTCACTCGAGTGAGTTTCTTCTGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030052.2-192s1c1
Sequence:CCGGCAAGACTCCAAGCATTCTGAACTCGAGTTCAGAATGCTTGGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks