EMAIL THIS PAGE TO A FRIEND

COX7B

cytochrome c oxidase subunit VIIb

57 Gene Product Result for
Synonyms: APLCC
UniProtKB ID: P24311, B2R4M3, Q6ICR1
Gene ID:
Human(1349) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIb, which is highly similar to bovine COX VIIb protein and is found in all tissues. This gene may have several pseudogenes on chromosomes 1, 2, 20 and 22. [provided by RefSeq, Jun 2011]
Mouse(66142) cytochrome c oxidase subunit VIIb
Rat(303393) cytochrome c oxidase subunit VIIb
Zebrafish(563476) cytochrome c oxidase subunit VIIb
cow(100300550) cytochrome c oxidase subunit VIIb
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001866 Rosetta Predictions human pricing
NM_182819 Rosetta Predictions rat pricing
NM_025379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063706 predicted 215
2 SASI_Hs01_00063707 predicted 198
3 SASI_Hs01_00063708 predicted 220
4 SASI_Hs01_00063709 predicted 216
5 SASI_Hs01_00063710 predicted 209
6 SASI_Hs01_00063712 predicted 219
7 SASI_Hs01_00063713 predicted 213
8 SASI_Hs01_00063714 predicted 216
9 SASI_Hs01_00063715 predicted 228
10 SASI_Hs01_00063711 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073712 predicted 310
2 SASI_Rn01_00073713 predicted 308
3 SASI_Rn02_00269846 predicted 274
4 SASI_Rn01_00073714 predicted 218
5 SASI_Rn02_00269847 predicted 85
6 SASI_Rn01_00073715 predicted 366
7 SASI_Rn01_00073716 predicted 225
8 SASI_Rn01_00073717 predicted 350
9 SASI_Rn01_00073719 predicted 358
10 SASI_Rn01_00073720 predicted 369
11 SASI_Rn01_00073718 predicted 307
12 SASI_Rn01_00073721 predicted 87
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198318 predicted 634
2 SASI_Mm01_00198320 predicted 495
3 SASI_Mm01_00198321 predicted 490
4 SASI_Mm01_00198324 predicted 287
5 SASI_Mm01_00198325 predicted 656
6 SASI_Mm01_00198326 predicted 275
7 SASI_Mm01_00198327 predicted 231
8 SASI_Mm02_00328108 predicted 415
9 SASI_Mm02_00328109 predicted 350
10 SASI_Mm01_00198319 predicted 551
11 SASI_Mm01_00198322 predicted 506
12 SASI_Mm01_00198323 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001866
COX7B MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIb
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-195s1c1
Sequence:CCGGCAAATACGGTAATGCTGTATTCTCGAGAATACAGCATTACCGTATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-234s1c1
Sequence:CCGGCTGTATTGTTACATGGACATACTCGAGTATGTCCATGTAACAATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-121s1c1
Sequence:CCGGCGTCTCCAAGTTCGAAGCATTCTCGAGAATGCTTCGAACTTGGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-259s1c1
Sequence:CCGGGCAACACAAGTCGGAATAGAACTCGAGTTCTATTCCGACTTGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-168s1c1
Sequence:CCGGCCAGAAACGTACACCTGATTTCTCGAGAAATCAGGTGTACGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001866
COX7B MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIb
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-195s1c1
Sequence:CCGGCAAATACGGTAATGCTGTATTCTCGAGAATACAGCATTACCGTATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-234s1c1
Sequence:CCGGCTGTATTGTTACATGGACATACTCGAGTATGTCCATGTAACAATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-121s1c1
Sequence:CCGGCGTCTCCAAGTTCGAAGCATTCTCGAGAATGCTTCGAACTTGGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-259s1c1
Sequence:CCGGGCAACACAAGTCGGAATAGAACTCGAGTTCTATTCCGACTTGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-168s1c1
Sequence:CCGGCCAGAAACGTACACCTGATTTCTCGAGAAATCAGGTGTACGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001866
COX7B MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIb
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-195s1c1
Sequence:CCGGCAAATACGGTAATGCTGTATTCTCGAGAATACAGCATTACCGTATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-234s1c1
Sequence:CCGGCTGTATTGTTACATGGACATACTCGAGTATGTCCATGTAACAATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-121s1c1
Sequence:CCGGCGTCTCCAAGTTCGAAGCATTCTCGAGAATGCTTCGAACTTGGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-259s1c1
Sequence:CCGGGCAACACAAGTCGGAATAGAACTCGAGTTCTATTCCGACTTGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001866.2-168s1c1
Sequence:CCGGCCAGAAACGTACACCTGATTTCTCGAGAAATCAGGTGTACGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025379
VALIDATED
COX7B MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIb
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-226s1c1
Sequence:CCGGCTGTGTTTCTACATGGACATACTCGAGTATGTCCATGTAGAAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-252s1c1
Sequence:CCGGCCACACAAATTGGAATAGAATCTCGAGATTCTATTCCAATTTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025379.1-248s1c1
Sequence:CCGGACAGCCACACAAATTGGAATACTCGAGTATTCCAATTTGTGTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-225s1c1
Sequence:CCGGTCTGTGTTTCTACATGGACATCTCGAGATGTCCATGTAGAAACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-170s1c1
Sequence:CCGGGCACCTAGTTTCCATGACAAACTCGAGTTTGTCATGGAAACTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025379.2-375s21c1
Sequence:CCGGTCGTGCCAGCTGGTACAATAACTCGAGTTATTGTACCAGCTGGCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-297s21c1
Sequence:CCGGACAGCCACACAAATTGGAATACTCGAGTATTCCAATTTGTGTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-219s21c1
Sequence:CCGGGCACCTAGTTTCCATGACAAACTCGAGTTTGTCATGGAAACTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-274s21c1
Sequence:CCGGTCTGTGTTTCTACATGGACATCTCGAGATGTCCATGTAGAAACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025379
VALIDATED
COX7B MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIb
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-226s1c1
Sequence:CCGGCTGTGTTTCTACATGGACATACTCGAGTATGTCCATGTAGAAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-252s1c1
Sequence:CCGGCCACACAAATTGGAATAGAATCTCGAGATTCTATTCCAATTTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025379.1-248s1c1
Sequence:CCGGACAGCCACACAAATTGGAATACTCGAGTATTCCAATTTGTGTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-225s1c1
Sequence:CCGGTCTGTGTTTCTACATGGACATCTCGAGATGTCCATGTAGAAACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-170s1c1
Sequence:CCGGGCACCTAGTTTCCATGACAAACTCGAGTTTGTCATGGAAACTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025379.2-375s21c1
Sequence:CCGGTCGTGCCAGCTGGTACAATAACTCGAGTTATTGTACCAGCTGGCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-297s21c1
Sequence:CCGGACAGCCACACAAATTGGAATACTCGAGTATTCCAATTTGTGTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-219s21c1
Sequence:CCGGGCACCTAGTTTCCATGACAAACTCGAGTTTGTCATGGAAACTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-274s21c1
Sequence:CCGGTCTGTGTTTCTACATGGACATCTCGAGATGTCCATGTAGAAACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025379
VALIDATED
COX7B MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIb
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-226s1c1
Sequence:CCGGCTGTGTTTCTACATGGACATACTCGAGTATGTCCATGTAGAAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-252s1c1
Sequence:CCGGCCACACAAATTGGAATAGAATCTCGAGATTCTATTCCAATTTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025379.1-248s1c1
Sequence:CCGGACAGCCACACAAATTGGAATACTCGAGTATTCCAATTTGTGTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-225s1c1
Sequence:CCGGTCTGTGTTTCTACATGGACATCTCGAGATGTCCATGTAGAAACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025379.1-170s1c1
Sequence:CCGGGCACCTAGTTTCCATGACAAACTCGAGTTTGTCATGGAAACTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025379.2-375s21c1
Sequence:CCGGTCGTGCCAGCTGGTACAATAACTCGAGTTATTGTACCAGCTGGCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-297s21c1
Sequence:CCGGACAGCCACACAAATTGGAATACTCGAGTATTCCAATTTGTGTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-219s21c1
Sequence:CCGGGCACCTAGTTTCCATGACAAACTCGAGTTTGTCATGGAAACTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025379.2-274s21c1
Sequence:CCGGTCTGTGTTTCTACATGGACATCTCGAGATGTCCATGTAGAAACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)