EMAIL THIS PAGE TO A FRIEND

COX7C

cytochrome c oxidase subunit VIIc

UniProtKB ID: P15954, Q6NR81
Gene ID:
Human(1350) Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes subunit VIIc, which shares 87% and 85% amino acid sequence identity with mouse and bovine COX VIIc, respectively, and is found in all tissues. A pseudogene COX7CP1 has been found on chromosome 13. [provided by RefSeq, Jul 2008]
Mouse(12867) cytochrome c oxidase subunit VIIc
Rat(100188937) cytochrome c oxidase, subunit VIIc
Zebrafish(336118) cytochrome c oxidase, subunit VIIc
chicken(431629) cytochrome c oxidase subunit VIIc
cow(327718) cytochrome c oxidase subunit VIIc
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001867 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112371 MISSION® esiRNA esiRNA human COX7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001867 Rosetta Predictions human pricing
NM_001134705 Rosetta Predictions rat pricing
NM_007749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099260 predicted 331
2 SASI_Hs01_00099261 predicted 186
3 SASI_Hs01_00099263 predicted 343
4 SASI_Hs01_00099264 predicted 247
5 SASI_Hs01_00099265 predicted 347
6 SASI_Hs01_00099266 predicted 195
7 SASI_Hs01_00099267 predicted 359
8 SASI_Hs01_00099268 predicted 231
9 SASI_Hs02_00332699 predicted 357
10 SASI_Hs02_00332700 predicted 356
11 SASI_Hs01_00099262 predicted 100
12 SASI_Hs01_00099269 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258064 predicted 244
2 SASI_Rn02_00258065 predicted 237
3 SASI_Rn02_00258066 predicted 235
4 SASI_Rn02_00258067 predicted 239
5 SASI_Rn02_00258068 predicted 238
6 SASI_Rn02_00258069 predicted 242
7 SASI_Rn02_00258070 predicted 235
8 SASI_Rn02_00258071 predicted 233
9 SASI_Rn02_00258072 predicted 250
10 SASI_Rn02_00258073 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130044 predicted 216
2 SASI_Mm01_00130045 predicted 216
3 SASI_Mm01_00130046 predicted 212
4 SASI_Mm01_00130047 predicted 219
5 SASI_Mm02_00312357 predicted 332
6 SASI_Mm01_00130048 predicted 285
7 SASI_Mm01_00130050 predicted 363
8 SASI_Mm01_00130051 predicted 261
9 SASI_Mm01_00130052 predicted 264
10 SASI_Mm01_00130053 predicted 328
11 SASI_Mm01_00130049 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001867
VALIDATED
COX7C MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIc
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-156s1c1
Sequence:CCGGCCTGGGAAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-214s1c1
Sequence:CCGGGTTTGTACTTTGGATCTGCATCTCGAGATGCAGATCCAAAGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-237s1c1
Sequence:CCGGGCTACACCCTTCCTTGTAGTACTCGAGTACTACAAGGAAGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-204s1c1
Sequence:CCGGGCTAAGATGTGTTTGTACTTTCTCGAGAAAGTACAAACACATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-196s1c1
Sequence:CCGGCGTTACTAGCTAAGATGTGTTCTCGAGAACACATCTTAGCTAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-237s21c1
Sequence:CCGGGCTACACCCTTCCTTGTAGTACTCGAGTACTACAAGGAAGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-156s21c1
Sequence:CCGGCCTGGGAAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-196s21c1
Sequence:CCGGCGTTACTAGCTAAGATGTGTTCTCGAGAACACATCTTAGCTAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-214s21c1
Sequence:CCGGGTTTGTACTTTGGATCTGCATCTCGAGATGCAGATCCAAAGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001867
VALIDATED
COX7C MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIc
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-156s1c1
Sequence:CCGGCCTGGGAAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-214s1c1
Sequence:CCGGGTTTGTACTTTGGATCTGCATCTCGAGATGCAGATCCAAAGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-237s1c1
Sequence:CCGGGCTACACCCTTCCTTGTAGTACTCGAGTACTACAAGGAAGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-204s1c1
Sequence:CCGGGCTAAGATGTGTTTGTACTTTCTCGAGAAAGTACAAACACATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-196s1c1
Sequence:CCGGCGTTACTAGCTAAGATGTGTTCTCGAGAACACATCTTAGCTAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-237s21c1
Sequence:CCGGGCTACACCCTTCCTTGTAGTACTCGAGTACTACAAGGAAGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-156s21c1
Sequence:CCGGCCTGGGAAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-196s21c1
Sequence:CCGGCGTTACTAGCTAAGATGTGTTCTCGAGAACACATCTTAGCTAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-214s21c1
Sequence:CCGGGTTTGTACTTTGGATCTGCATCTCGAGATGCAGATCCAAAGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001867
VALIDATED
COX7C MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIc
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-156s1c1
Sequence:CCGGCCTGGGAAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-214s1c1
Sequence:CCGGGTTTGTACTTTGGATCTGCATCTCGAGATGCAGATCCAAAGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-237s1c1
Sequence:CCGGGCTACACCCTTCCTTGTAGTACTCGAGTACTACAAGGAAGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-204s1c1
Sequence:CCGGGCTAAGATGTGTTTGTACTTTCTCGAGAAAGTACAAACACATCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001867.2-196s1c1
Sequence:CCGGCGTTACTAGCTAAGATGTGTTCTCGAGAACACATCTTAGCTAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-237s21c1
Sequence:CCGGGCTACACCCTTCCTTGTAGTACTCGAGTACTACAAGGAAGGGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-156s21c1
Sequence:CCGGCCTGGGAAGAATTTGCCATTTCTCGAGAAATGGCAAATTCTTCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-196s21c1
Sequence:CCGGCGTTACTAGCTAAGATGTGTTCTCGAGAACACATCTTAGCTAGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001867.2-214s21c1
Sequence:CCGGGTTTGTACTTTGGATCTGCATCTCGAGATGCAGATCCAAAGTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007749
VALIDATED
COX7C MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIc
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-234s1c1
Sequence:CCGGGCCGCACCTTTCTTTATAGTACTCGAGTACTATAAAGAAAGGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-212s1c1
Sequence:CCGGCGTGTACTTTGGATCTGGGTTCTCGAGAACCCAGATCCAAAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-235s1c1
Sequence:CCGGCCGCACCTTTCTTTATAGTAACTCGAGTTACTATAAAGAAAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-201s1c1
Sequence:CCGGGCTATGATGACCGTGTACTTTCTCGAGAAAGTACACGGTCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007749.1-245s1c1
Sequence:CCGGCTTTATAGTAAGACACCAGCTCTCGAGAGCTGGTGTCTTACTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007749
VALIDATED
COX7C MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIc
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-234s1c1
Sequence:CCGGGCCGCACCTTTCTTTATAGTACTCGAGTACTATAAAGAAAGGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-212s1c1
Sequence:CCGGCGTGTACTTTGGATCTGGGTTCTCGAGAACCCAGATCCAAAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-235s1c1
Sequence:CCGGCCGCACCTTTCTTTATAGTAACTCGAGTTACTATAAAGAAAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-201s1c1
Sequence:CCGGGCTATGATGACCGTGTACTTTCTCGAGAAAGTACACGGTCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007749.1-245s1c1
Sequence:CCGGCTTTATAGTAAGACACCAGCTCTCGAGAGCTGGTGTCTTACTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007749
VALIDATED
COX7C MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIc
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-234s1c1
Sequence:CCGGGCCGCACCTTTCTTTATAGTACTCGAGTACTATAAAGAAAGGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-212s1c1
Sequence:CCGGCGTGTACTTTGGATCTGGGTTCTCGAGAACCCAGATCCAAAGTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-235s1c1
Sequence:CCGGCCGCACCTTTCTTTATAGTAACTCGAGTTACTATAAAGAAAGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007749.1-201s1c1
Sequence:CCGGGCTATGATGACCGTGTACTTTCTCGAGAAAGTACACGGTCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007749.1-245s1c1
Sequence:CCGGCTTTATAGTAAGACACCAGCTCTCGAGAGCTGGTGTCTTACTATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks