EMAIL THIS PAGE TO A FRIEND

COX8A

cytochrome c oxidase subunit VIIIA (ubiquitous)

63 Gene Product Result for
Synonyms: COX COX8 COX8-2 COX8L VIII VIII-L
UniProtKB ID: P10176, P15955
Gene ID:
Human(1351) Summary: The protein encoded by this gene is the terminal enzyme of the respiratory chain, coupling the transfer of electrons from cytochrome c to molecular oxygen, with the concomitant production of a proton electrochemical gradient across the inner mitochondrial membrane. In addition to 3 mitochondrially encoded subunits, which perform the catalytic function, the eukaryotic enzyme contains nuclear-encoded smaller subunits, ranging in number from 4 in some organisms to 10 in mammals. It has been proposed that nuclear-encoded subunits may be involved in the modulation of the catalytic function. This gene encodes one of the nuclear-encoded subunits. [provided by RefSeq, Jul 2008]
Mouse(12868) cytochrome c oxidase subunit VIIIa
Rat(171335) cytochrome c oxidase subunit VIIIa
Zebrafish(557348) cytochrome c oxidase subunit 8a
chicken(775974) cytochrome c oxidase subunit VIIIA (ubiquitous)
dog(476040) cytochrome c oxidase subunit VIIIA (ubiquitous)
cow(281091) cytochrome c oxidase subunit VIIIA (ubiquitous)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004074 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058331 MISSION® esiRNA esiRNA human COX8A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004074 Rosetta Predictions human pricing
NM_134345 Rosetta Predictions rat pricing
NM_007750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011818 predicted 232
2 SASI_Hs01_00011819 predicted 197
3 SASI_Hs01_00011820 predicted 257
4 SASI_Hs01_00011821 predicted 226
5 SASI_Hs01_00011822 predicted 258
6 SASI_Hs01_00011823 predicted 238
7 SASI_Hs01_00011824 predicted 198
8 SASI_Hs01_00011825 predicted 185
9 SASI_Hs01_00011826 predicted 329
10 SASI_Hs01_00011827 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059364 predicted 267
2 SASI_Rn01_00059365 predicted 214
3 SASI_Rn01_00059366 predicted 267
4 SASI_Rn01_00059367 predicted 268
5 SASI_Rn01_00059368 predicted 256
6 SASI_Rn01_00059369 predicted 264
7 SASI_Rn01_00059370 predicted 232
8 SASI_Rn01_00059371 predicted 230
9 SASI_Rn01_00059372 predicted 265
10 SASI_Rn01_00059373 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033554 predicted 319
2 SASI_Mm01_00033556 predicted 235
3 SASI_Mm01_00033557 predicted 322
4 SASI_Mm01_00033558 predicted 309
5 SASI_Mm01_00033562 predicted 314
6 SASI_Mm02_00312358 predicted 230
7 SASI_Mm02_00312359 predicted 226
8 SASI_Mm02_00312360 predicted 320
9 SASI_Mm01_00033555 predicted 307
10 SASI_Mm02_00312361 predicted 231
11 SASI_Mm01_00033559 predicted 222
12 SASI_Mm01_00033560 predicted 303
13 SASI_Mm01_00033561 predicted 240
14 SASI_Mm01_00033563 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007750
VALIDATED
COX8A MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIIA (ubiquitous)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-292s21c1
Sequence:CCGGAGAGCTACAAGAAGCGGGAGTCTCGAGACTCCCGCTTCTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-91s1c2
Sequence:CCGGGCGGGCTCAGGTCCACTCGAACTCGAGTTCGAGTGGACCTGAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007750.2-400s21c1
Sequence:CCGGCCCGGGATCATGTTATTCAATCTCGAGATTGAATAACATGATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-242s21c1
Sequence:CCGGCTGCTTCGTGTGTTGTCTTCTCTCGAGAGAAGACAACACACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-226s21c1
Sequence:CCGGCCATTGGGCTCACTTCCTGCTCTCGAGAGCAGGAAGTGAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-163s1c1
Sequence:CCGGCTGCTTCGTGTGTTGTCTTCTCTCGAGAGAAGACAACACACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-213s1c1
Sequence:CCGGAGAGCTACAAGAAGCGGGAGTCTCGAGACTCCCGCTTCTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-147s1c1
Sequence:CCGGCCATTGGGCTCACTTCCTGCTCTCGAGAGCAGGAAGTGAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007750
VALIDATED
COX8A MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIIA (ubiquitous)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-292s21c1
Sequence:CCGGAGAGCTACAAGAAGCGGGAGTCTCGAGACTCCCGCTTCTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-91s1c2
Sequence:CCGGGCGGGCTCAGGTCCACTCGAACTCGAGTTCGAGTGGACCTGAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007750.2-400s21c1
Sequence:CCGGCCCGGGATCATGTTATTCAATCTCGAGATTGAATAACATGATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-242s21c1
Sequence:CCGGCTGCTTCGTGTGTTGTCTTCTCTCGAGAGAAGACAACACACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-226s21c1
Sequence:CCGGCCATTGGGCTCACTTCCTGCTCTCGAGAGCAGGAAGTGAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-163s1c1
Sequence:CCGGCTGCTTCGTGTGTTGTCTTCTCTCGAGAGAAGACAACACACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-213s1c1
Sequence:CCGGAGAGCTACAAGAAGCGGGAGTCTCGAGACTCCCGCTTCTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-147s1c1
Sequence:CCGGCCATTGGGCTCACTTCCTGCTCTCGAGAGCAGGAAGTGAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007750
VALIDATED
COX8A MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIIA (ubiquitous)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-292s21c1
Sequence:CCGGAGAGCTACAAGAAGCGGGAGTCTCGAGACTCCCGCTTCTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-91s1c2
Sequence:CCGGGCGGGCTCAGGTCCACTCGAACTCGAGTTCGAGTGGACCTGAGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007750.2-400s21c1
Sequence:CCGGCCCGGGATCATGTTATTCAATCTCGAGATTGAATAACATGATCCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-242s21c1
Sequence:CCGGCTGCTTCGTGTGTTGTCTTCTCTCGAGAGAAGACAACACACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007750.2-226s21c1
Sequence:CCGGCCATTGGGCTCACTTCCTGCTCTCGAGAGCAGGAAGTGAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-163s1c1
Sequence:CCGGCTGCTTCGTGTGTTGTCTTCTCTCGAGAGAAGACAACACACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-213s1c1
Sequence:CCGGAGAGCTACAAGAAGCGGGAGTCTCGAGACTCCCGCTTCTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007750.1-147s1c1
Sequence:CCGGCCATTGGGCTCACTTCCTGCTCTCGAGAGCAGGAAGTGAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004074
VALIDATED
COX8A MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIIA (ubiquitous)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-212s21c1
Sequence:CCGGCTGCTTCGTGACCTTCCTCCTCTCGAGAGGAGGAAGGTCACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-337s21c1
Sequence:CCGGCCTGGTCATGTTACTGCATTTCTCGAGAAATGCAGTAACATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004074.2-265s21c1
Sequence:CCGGCCTACAGGAGGCCAGAGTGAACTCGAGTTCACTCTGGCCTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-248s21c1
Sequence:CCGGCCTGTCACACCTGGAGACCTACTCGAGTAGGTCTCCAGGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-172s21c1
Sequence:CCGGGGAAGCTTGGGATCATGGAATCTCGAGATTCCATGATCCCAAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-141s1c1
Sequence:CCGGCGCGCCAAGATCCATTCGTTGCTCGAGCAACGAATGGATCTTGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-212s1c1
Sequence:CCGGCTGCTTCGTGACCTTCCTCCTCTCGAGAGGAGGAAGGTCACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-236s1c1
Sequence:CCGGAGCGGGCTGGATCCTGTCACACTCGAGTGTGACAGGATCCAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004074.2-185s1c1
Sequence:CCGGCATGGAATTGGCCGTTGGGCTCTCGAGAGCCCAACGGCCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-248s1c1
Sequence:CCGGCCTGTCACACCTGGAGACCTACTCGAGTAGGTCTCCAGGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004074
VALIDATED
COX8A MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIIA (ubiquitous)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-212s21c1
Sequence:CCGGCTGCTTCGTGACCTTCCTCCTCTCGAGAGGAGGAAGGTCACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-337s21c1
Sequence:CCGGCCTGGTCATGTTACTGCATTTCTCGAGAAATGCAGTAACATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004074.2-265s21c1
Sequence:CCGGCCTACAGGAGGCCAGAGTGAACTCGAGTTCACTCTGGCCTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-248s21c1
Sequence:CCGGCCTGTCACACCTGGAGACCTACTCGAGTAGGTCTCCAGGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-172s21c1
Sequence:CCGGGGAAGCTTGGGATCATGGAATCTCGAGATTCCATGATCCCAAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-141s1c1
Sequence:CCGGCGCGCCAAGATCCATTCGTTGCTCGAGCAACGAATGGATCTTGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-212s1c1
Sequence:CCGGCTGCTTCGTGACCTTCCTCCTCTCGAGAGGAGGAAGGTCACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-236s1c1
Sequence:CCGGAGCGGGCTGGATCCTGTCACACTCGAGTGTGACAGGATCCAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004074.2-185s1c1
Sequence:CCGGCATGGAATTGGCCGTTGGGCTCTCGAGAGCCCAACGGCCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-248s1c1
Sequence:CCGGCCTGTCACACCTGGAGACCTACTCGAGTAGGTCTCCAGGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004074
VALIDATED
COX8A MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIIA (ubiquitous)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-212s21c1
Sequence:CCGGCTGCTTCGTGACCTTCCTCCTCTCGAGAGGAGGAAGGTCACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-337s21c1
Sequence:CCGGCCTGGTCATGTTACTGCATTTCTCGAGAAATGCAGTAACATGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004074.2-265s21c1
Sequence:CCGGCCTACAGGAGGCCAGAGTGAACTCGAGTTCACTCTGGCCTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-248s21c1
Sequence:CCGGCCTGTCACACCTGGAGACCTACTCGAGTAGGTCTCCAGGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004074.2-172s21c1
Sequence:CCGGGGAAGCTTGGGATCATGGAATCTCGAGATTCCATGATCCCAAGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-141s1c1
Sequence:CCGGCGCGCCAAGATCCATTCGTTGCTCGAGCAACGAATGGATCTTGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-212s1c1
Sequence:CCGGCTGCTTCGTGACCTTCCTCCTCTCGAGAGGAGGAAGGTCACGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-236s1c1
Sequence:CCGGAGCGGGCTGGATCCTGTCACACTCGAGTGTGACAGGATCCAGCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004074.2-185s1c1
Sequence:CCGGCATGGAATTGGCCGTTGGGCTCTCGAGAGCCCAACGGCCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004074.2-248s1c1
Sequence:CCGGCCTGTCACACCTGGAGACCTACTCGAGTAGGTCTCCAGGTGTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks