EMAIL THIS PAGE TO A FRIEND

COX8C

cytochrome c oxidase subunit VIIIC

69 Gene Product Result for
Synonyms: COX8-3
UniProtKB ID: Q7Z4L0, Q495K7
Gene ID:
Mouse(75483) cytochrome c oxidase subunit VIIIc
Rat(360229) cytochrome c oxidase, subunit VIIIc
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003127 Anti-COX8C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182971 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148301 MISSION® esiRNA esiRNA targeting mouse Cox8c mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182971 Rosetta Predictions human pricing
NM_183055 Rosetta Predictions rat pricing
NM_001039049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053557 predicted 208
2 SASI_Hs01_00053558 predicted 194
3 SASI_Hs01_00053559 predicted 197
4 SASI_Hs01_00053560 predicted 279
5 SASI_Hs01_00053561 predicted 209
6 SASI_Hs01_00053562 predicted 304
7 SASI_Hs01_00053563 predicted 201
8 SASI_Hs01_00053564 predicted 253
9 SASI_Hs01_00053565 predicted 194
10 SASI_Hs01_00053566 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082700 predicted 220
2 SASI_Rn01_00082701 predicted 217
3 SASI_Rn01_00082702 predicted 229
4 SASI_Rn01_00082703 predicted 230
5 SASI_Rn01_00082704 predicted 211
6 SASI_Rn01_00082705 predicted 211
7 SASI_Rn01_00082706 predicted 225
8 SASI_Rn01_00082707 predicted 216
9 SASI_Rn01_00082708 predicted 307
10 SASI_Rn01_00082709 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289733 predicted 183
2 SASI_Mm01_00053082 predicted 417
3 SASI_Mm01_00053083 predicted 345
4 SASI_Mm01_00053084 predicted 357
5 SASI_Mm01_00053085 predicted 179
6 SASI_Mm02_00289734 predicted 232
7 SASI_Mm01_00053087 predicted 428
8 SASI_Mm01_00053088 predicted 220
9 SASI_Mm01_00053089 predicted 349
10 SASI_Mm01_00053091 predicted 70
11 SASI_Mm01_00053086 predicted 247
12 SASI_Mm01_00053090 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039049
COX8C MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIIC
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-246s21c1
Sequence:CCGGGCTAAGCAGTCTGAAGTATTTCTCGAGAAATACTTCAGACTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039049.1-300s21c1
Sequence:CCGGGCACGGCATGGCTCCTTTAAACTCGAGTTTAAAGGAGCCATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-270s21c1
Sequence:CCGGAGGAGAGTAGATACAGGATGTCTCGAGACATCCTGTATCTACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-185s21c1
Sequence:CCGGCGGAATCAGCTGTTGGGATTGCTCGAGCAATCCCAACAGCTGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-145s21c1
Sequence:CCGGAGCCACTCAGAAAGCCCACAACTCGAGTTGTGGGCTTTCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039049
COX8C MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIIC
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-246s21c1
Sequence:CCGGGCTAAGCAGTCTGAAGTATTTCTCGAGAAATACTTCAGACTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039049.1-300s21c1
Sequence:CCGGGCACGGCATGGCTCCTTTAAACTCGAGTTTAAAGGAGCCATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-270s21c1
Sequence:CCGGAGGAGAGTAGATACAGGATGTCTCGAGACATCCTGTATCTACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-185s21c1
Sequence:CCGGCGGAATCAGCTGTTGGGATTGCTCGAGCAATCCCAACAGCTGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-145s21c1
Sequence:CCGGAGCCACTCAGAAAGCCCACAACTCGAGTTGTGGGCTTTCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039049
COX8C MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIIC
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-246s21c1
Sequence:CCGGGCTAAGCAGTCTGAAGTATTTCTCGAGAAATACTTCAGACTGCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039049.1-300s21c1
Sequence:CCGGGCACGGCATGGCTCCTTTAAACTCGAGTTTAAAGGAGCCATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-270s21c1
Sequence:CCGGAGGAGAGTAGATACAGGATGTCTCGAGACATCCTGTATCTACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-185s21c1
Sequence:CCGGCGGAATCAGCTGTTGGGATTGCTCGAGCAATCCCAACAGCTGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039049.1-145s21c1
Sequence:CCGGAGCCACTCAGAAAGCCCACAACTCGAGTTGTGGGCTTTCTGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182971
COX8C MISSION shRNA Bacterial Glycerol Stock
cytochrome c oxidase subunit VIIIC
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-211s1c1
Sequence:CCGGGCTGTTGGACTTGTGGTGTTTCTCGAGAAACACCACAAGTCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-269s1c1
Sequence:CCGGGCAACCTGAAGCAGTTCAGAACTCGAGTTCTGAACTGCTTCAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-264s1c1
Sequence:CCGGGCTAGGCAACCTGAAGCAGTTCTCGAGAACTGCTTCAGGTTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-202s1c1
Sequence:CCGGGCGGAAATGGCTGTTGGACTTCTCGAGAAGTCCAACAGCCATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-235s1c1
Sequence:CCGGACGACCTTCTTAACACCAGCTCTCGAGAGCTGGTGTTAAGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182971
COX8C MISSION shRNA shRNA Plasmid DNA
cytochrome c oxidase subunit VIIIC
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-211s1c1
Sequence:CCGGGCTGTTGGACTTGTGGTGTTTCTCGAGAAACACCACAAGTCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-269s1c1
Sequence:CCGGGCAACCTGAAGCAGTTCAGAACTCGAGTTCTGAACTGCTTCAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-264s1c1
Sequence:CCGGGCTAGGCAACCTGAAGCAGTTCTCGAGAACTGCTTCAGGTTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-202s1c1
Sequence:CCGGGCGGAAATGGCTGTTGGACTTCTCGAGAAGTCCAACAGCCATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-235s1c1
Sequence:CCGGACGACCTTCTTAACACCAGCTCTCGAGAGCTGGTGTTAAGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182971
COX8C MISSION shRNA Lentiviral Transduction Particles
cytochrome c oxidase subunit VIIIC
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-211s1c1
Sequence:CCGGGCTGTTGGACTTGTGGTGTTTCTCGAGAAACACCACAAGTCCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-269s1c1
Sequence:CCGGGCAACCTGAAGCAGTTCAGAACTCGAGTTCTGAACTGCTTCAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-264s1c1
Sequence:CCGGGCTAGGCAACCTGAAGCAGTTCTCGAGAACTGCTTCAGGTTGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-202s1c1
Sequence:CCGGGCGGAAATGGCTGTTGGACTTCTCGAGAAGTCCAACAGCCATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182971.1-235s1c1
Sequence:CCGGACGACCTTCTTAACACCAGCTCTCGAGAGCTGGTGTTAAGAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks