EMAIL THIS PAGE TO A FRIEND

CPA1

carboxypeptidase A1 (pancreatic)

63 Gene Product Result for
Synonyms: CPA
UniProtKB ID: P15085, A4D1M1, Q53XU0, Q9BS67, Q9UCF2
Gene ID:
Human(1357) Summary: Three different forms of human pancreatic procarboxypeptidase A have been isolated. This gene encodes a monomeric pancreatic exopeptidase involved in zymogen inhibition. [provided by RefSeq, Jan 2009]
Mouse(109697) carboxypeptidase A1, pancreatic
Rat(24269) carboxypeptidase A1 (pancreatic)
Zebrafish(325886) carboxypeptidase A1 (pancreatic)
chicken(395276) carboxypeptidase A1 (pancreatic)
dog(475192) carboxypeptidase A1 (pancreatic)
cow(286762) carboxypeptidase A1 (pancreatic)
domestic cat(101089929) carboxypeptidase A1 (pancreatic)
sheep(101117326) carboxypeptidase A1 (pancreatic)
naked mole-rat(101699386) carboxypeptidase A1 (pancreatic)
domestic guinea pig(100736043) carboxypeptidase A1 (pancreatic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B8011 DL-Benzylsuccinic acid ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001868 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_284174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_284174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_284174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045561 MISSION® esiRNA esiRNA human CPA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001868 Rosetta Predictions human pricing
NM_016998 Rosetta Predictions rat pricing
NM_025350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135620 predicted 453
2 SASI_Hs01_00135621 predicted 468
3 SASI_Hs01_00135622 predicted 657
4 SASI_Hs01_00135623 predicted 1026
5 SASI_Hs01_00135624 predicted 936
6 SASI_Hs01_00135625 predicted 615
7 SASI_Hs01_00135627 predicted 412
8 SASI_Hs01_00135628 predicted 311
9 SASI_Hs01_00135629 predicted 604
10 SASI_Hs02_00332701 predicted 831
11 SASI_Hs01_00135626 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091553 predicted 566
2 SASI_Rn02_00261140 predicted 536
3 SASI_Rn02_00261141 predicted 527
4 SASI_Rn01_00091555 predicted 356
5 SASI_Rn02_00261142 predicted 1301
6 SASI_Rn01_00091556 predicted 1358
7 SASI_Rn01_00091558 predicted 1117
8 SASI_Rn01_00091559 predicted 550
9 SASI_Rn01_00091560 predicted 1365
10 SASI_Rn02_00261143 predicted 666
11 SASI_Rn01_00091551 predicted 534
12 SASI_Rn01_00091552 predicted 554
13 SASI_Rn01_00091554 predicted 560
14 SASI_Rn01_00091557 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157375 predicted 1287
2 SASI_Mm01_00157377 predicted 1280
3 SASI_Mm01_00157378 predicted 495
4 SASI_Mm01_00157379 predicted 474
5 SASI_Mm01_00157380 predicted 900
6 SASI_Mm02_00328019 predicted 1292
7 SASI_Mm01_00157381 predicted 500
8 SASI_Mm01_00157382 predicted 708
9 SASI_Mm01_00157383 predicted 605
10 SASI_Mm02_00328020 predicted 1263
11 SASI_Mm01_00157374 predicted 386
12 SASI_Mm01_00157376 predicted 1336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001868
CPA1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A1 (pancreatic)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-287s21c1
Sequence:CCGGTCCAGGCGGTCAAGATCTTTCCTCGAGGAAAGATCTTGACCGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-524s21c1
Sequence:CCGGCCTATGAAGGGCGTCCCATTTCTCGAGAAATGGGACGCCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-890s21c1
Sequence:CCGGAGACTTACCACGGCAAGTTTGCTCGAGCAAACTTGCCGTGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-469s1c1
Sequence:CCGGGCGTCCCATTTATGTGCTGAACTCGAGTTCAGCACATAAATGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-940s1c1
Sequence:CCGGCCTCATGTATCCCTATGGCTACTCGAGTAGCCATAGGGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-1059s1c1
Sequence:CCGGGCAGCATCATCAAGGCAATTTCTCGAGAAATTGCCTTGATGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-430s1c1
Sequence:CCGGCCTTGTCAGCAAGATCCAGATCTCGAGATCTGGATCTTGCTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-875s1c1
Sequence:CCGGGTAGACTTTGTGAAGGACCATCTCGAGATGGTCCTTCACAAAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001868
CPA1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A1 (pancreatic)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-287s21c1
Sequence:CCGGTCCAGGCGGTCAAGATCTTTCCTCGAGGAAAGATCTTGACCGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-524s21c1
Sequence:CCGGCCTATGAAGGGCGTCCCATTTCTCGAGAAATGGGACGCCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-890s21c1
Sequence:CCGGAGACTTACCACGGCAAGTTTGCTCGAGCAAACTTGCCGTGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-469s1c1
Sequence:CCGGGCGTCCCATTTATGTGCTGAACTCGAGTTCAGCACATAAATGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-940s1c1
Sequence:CCGGCCTCATGTATCCCTATGGCTACTCGAGTAGCCATAGGGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-1059s1c1
Sequence:CCGGGCAGCATCATCAAGGCAATTTCTCGAGAAATTGCCTTGATGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-430s1c1
Sequence:CCGGCCTTGTCAGCAAGATCCAGATCTCGAGATCTGGATCTTGCTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-875s1c1
Sequence:CCGGGTAGACTTTGTGAAGGACCATCTCGAGATGGTCCTTCACAAAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001868
CPA1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A1 (pancreatic)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-287s21c1
Sequence:CCGGTCCAGGCGGTCAAGATCTTTCCTCGAGGAAAGATCTTGACCGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-524s21c1
Sequence:CCGGCCTATGAAGGGCGTCCCATTTCTCGAGAAATGGGACGCCCTTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001868.2-890s21c1
Sequence:CCGGAGACTTACCACGGCAAGTTTGCTCGAGCAAACTTGCCGTGGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-469s1c1
Sequence:CCGGGCGTCCCATTTATGTGCTGAACTCGAGTTCAGCACATAAATGGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-940s1c1
Sequence:CCGGCCTCATGTATCCCTATGGCTACTCGAGTAGCCATAGGGATACATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-1059s1c1
Sequence:CCGGGCAGCATCATCAAGGCAATTTCTCGAGAAATTGCCTTGATGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-430s1c1
Sequence:CCGGCCTTGTCAGCAAGATCCAGATCTCGAGATCTGGATCTTGCTGACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001868.1-875s1c1
Sequence:CCGGGTAGACTTTGTGAAGGACCATCTCGAGATGGTCCTTCACAAAGTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_284174
CPA1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A1 (pancreatic)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1295s1c1
Sequence:CCGGTGGCAGTATCATTGATACGATCTCGAGATCGTATCAATGATACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1360s1c1
Sequence:CCGGGCATCAAGTATTCCTTCACTTCTCGAGAAGTGAAGGAATACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-467s1c1
Sequence:CCGGCGTGAAAGCATTCTTGGAATACTCGAGTATTCCAAGAATGCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1061s1c1
Sequence:CCGGAGAAACTTACCGTGGCAAGTTCTCGAGAACTTGCCACGGTAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-466s1c1
Sequence:CCGGCCGTGAAAGCATTCTTGGAATCTCGAGATTCCAAGAATGCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_284174
CPA1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A1 (pancreatic)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1295s1c1
Sequence:CCGGTGGCAGTATCATTGATACGATCTCGAGATCGTATCAATGATACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1360s1c1
Sequence:CCGGGCATCAAGTATTCCTTCACTTCTCGAGAAGTGAAGGAATACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-467s1c1
Sequence:CCGGCGTGAAAGCATTCTTGGAATACTCGAGTATTCCAAGAATGCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1061s1c1
Sequence:CCGGAGAAACTTACCGTGGCAAGTTCTCGAGAACTTGCCACGGTAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-466s1c1
Sequence:CCGGCCGTGAAAGCATTCTTGGAATCTCGAGATTCCAAGAATGCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_284174
CPA1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A1 (pancreatic)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1295s1c1
Sequence:CCGGTGGCAGTATCATTGATACGATCTCGAGATCGTATCAATGATACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1360s1c1
Sequence:CCGGGCATCAAGTATTCCTTCACTTCTCGAGAAGTGAAGGAATACTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-467s1c1
Sequence:CCGGCGTGAAAGCATTCTTGGAATACTCGAGTATTCCAAGAATGCTTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-1061s1c1
Sequence:CCGGAGAAACTTACCGTGGCAAGTTCTCGAGAACTTGCCACGGTAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_284174.1-466s1c1
Sequence:CCGGCCGTGAAAGCATTCTTGGAATCTCGAGATTCCAAGAATGCTTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks