EMAIL THIS PAGE TO A FRIEND

CPA2

carboxypeptidase A2 (pancreatic)

58 Gene Product Result for
Gene ID:
Human(1358) Summary: Three different forms of human pancreatic procarboxypeptidase A have been isolated. The encoded protein represents the A2 form, which is a monomeric protein with different biochemical properties from the A1 and A3 forms. The A2 form of pancreatic procarboxypeptidase acts on aromatic C-terminal residues and is a secreted protein. [provided by RefSeq, Dec 2008]
Mouse(232680) carboxypeptidase A2, pancreatic
Rat(296959) carboxypeptidase A2 (pancreatic)
domestic guinea pig(100735021) carboxypeptidase A2 (pancreatic)
naked mole-rat(101700104) carboxypeptidase A2 (pancreatic)
Domestic Rabbit(100349998) carboxypeptidase A2 (pancreatic)
Zebrafish(445052) carboxypeptidase A2 (pancreatic)
chicken(416682) carboxypeptidase A2 (pancreatic)
dog(475193) carboxypeptidase A2 (pancreatic)
domestic cat(101088825) carboxypeptidase A2 (pancreatic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001869 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001869 Rosetta Predictions human pricing
NM_001013083 Rosetta Predictions rat pricing
NM_001024698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332702 predicted 734
2 SASI_Hs01_00029238 predicted 216
3 SASI_Hs01_00029239 predicted 461
4 SASI_Hs01_00029240 predicted 1048
5 SASI_Hs01_00029241 predicted 250
6 SASI_Hs01_00029242 predicted 246
7 SASI_Hs01_00029243 predicted 959
8 SASI_Hs01_00029245 predicted 418
9 SASI_Hs01_00029246 predicted 943
10 SASI_Hs01_00029247 predicted 558
11 SASI_Hs01_00029244 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088803 predicted 577
2 SASI_Rn01_00088804 predicted 266
3 SASI_Rn01_00088805 predicted 661
4 SASI_Rn01_00088806 predicted 1034
5 SASI_Rn01_00088808 predicted 568
6 SASI_Rn02_00200720 predicted 433
7 SASI_Rn01_00088810 predicted 577
8 SASI_Rn01_00088811 predicted 377
9 SASI_Rn02_00200721 predicted 418
10 SASI_Rn01_00088812 predicted 911
11 SASI_Rn01_00088807 predicted 431
12 SASI_Rn01_00088809 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287659 predicted 602
2 SASI_Mm01_00100070 predicted 628
3 SASI_Mm01_00100071 predicted 683
4 SASI_Mm01_00100072 predicted 338
5 SASI_Mm01_00100073 predicted 449
6 SASI_Mm02_00287660 predicted 856
7 SASI_Mm01_00100075 predicted 276
8 SASI_Mm01_00100076 predicted 429
9 SASI_Mm01_00100077 predicted 976
10 SASI_Mm02_00287661 predicted 807
11 SASI_Mm01_00100068 predicted 597
12 SASI_Mm01_00100069 predicted 299
13 SASI_Mm01_00100074 predicted 889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001869
CPA2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A2 (pancreatic)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-1035s1c1
Sequence:CCGGCCAAGTACAAAGTGGGACCAACTCGAGTTGGTCCCACTTTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-247s1c1
Sequence:CCGGCCAGGGAATTGCCTATTCCATCTCGAGATGGAATAGGCAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-466s1c1
Sequence:CCGGGCCTATGAACGTGCTCAAGTTCTCGAGAACTTGAGCACGTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-956s1c1
Sequence:CCGGTGTACCAAGTTAGATGACTTTCTCGAGAAAGTCATCTAACTTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-432s1c1
Sequence:CCGGGCAAAGTGAATATTGGCTCTTCTCGAGAAGAGCCAATATTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-358s21c1
Sequence:CCGGACGGAGTGGTAACTTCAATTTCTCGAGAAATTGAAGTTACCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-1130s21c1
Sequence:CCGGTATGGCATCAAGTACTCATTTCTCGAGAAATGAGTACTTGATGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-234s21c1
Sequence:CCGGTCAACGTCCAGGCAGTCAAAGCTCGAGCTTTGACTGCCTGGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001869
CPA2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A2 (pancreatic)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-1035s1c1
Sequence:CCGGCCAAGTACAAAGTGGGACCAACTCGAGTTGGTCCCACTTTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-247s1c1
Sequence:CCGGCCAGGGAATTGCCTATTCCATCTCGAGATGGAATAGGCAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-466s1c1
Sequence:CCGGGCCTATGAACGTGCTCAAGTTCTCGAGAACTTGAGCACGTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-956s1c1
Sequence:CCGGTGTACCAAGTTAGATGACTTTCTCGAGAAAGTCATCTAACTTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-432s1c1
Sequence:CCGGGCAAAGTGAATATTGGCTCTTCTCGAGAAGAGCCAATATTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-358s21c1
Sequence:CCGGACGGAGTGGTAACTTCAATTTCTCGAGAAATTGAAGTTACCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-1130s21c1
Sequence:CCGGTATGGCATCAAGTACTCATTTCTCGAGAAATGAGTACTTGATGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-234s21c1
Sequence:CCGGTCAACGTCCAGGCAGTCAAAGCTCGAGCTTTGACTGCCTGGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001869
CPA2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A2 (pancreatic)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-1035s1c1
Sequence:CCGGCCAAGTACAAAGTGGGACCAACTCGAGTTGGTCCCACTTTGTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-247s1c1
Sequence:CCGGCCAGGGAATTGCCTATTCCATCTCGAGATGGAATAGGCAATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-466s1c1
Sequence:CCGGGCCTATGAACGTGCTCAAGTTCTCGAGAACTTGAGCACGTTCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-956s1c1
Sequence:CCGGTGTACCAAGTTAGATGACTTTCTCGAGAAAGTCATCTAACTTGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001869.1-432s1c1
Sequence:CCGGGCAAAGTGAATATTGGCTCTTCTCGAGAAGAGCCAATATTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-358s21c1
Sequence:CCGGACGGAGTGGTAACTTCAATTTCTCGAGAAATTGAAGTTACCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-1130s21c1
Sequence:CCGGTATGGCATCAAGTACTCATTTCTCGAGAAATGAGTACTTGATGCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001869.2-234s21c1
Sequence:CCGGTCAACGTCCAGGCAGTCAAAGCTCGAGCTTTGACTGCCTGGACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133021
CPA2 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A2 (pancreatic)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-499s1c1
Sequence:CCGGTGGTCTAGTGAGCAAAGTGAACTCGAGTTCACTTTGCTCACTAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-1037s1c1
Sequence:CCGGGCCAAGCCAGATGACTTTAATCTCGAGATTAAAGTCATCTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-415s1c1
Sequence:CCGGGCGTGGCACTAACTTCAACTTCTCGAGAAGTTGAAGTTAGTGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-653s1c1
Sequence:CCGGGCAAATAAGATTGCGTCTGATCTCGAGATCAGACGCAATCTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-510s1c1
Sequence:CCGGGCAAAGTGAATATCGGTTCATCTCGAGATGAACCGATATTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133021
CPA2 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A2 (pancreatic)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-499s1c1
Sequence:CCGGTGGTCTAGTGAGCAAAGTGAACTCGAGTTCACTTTGCTCACTAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-1037s1c1
Sequence:CCGGGCCAAGCCAGATGACTTTAATCTCGAGATTAAAGTCATCTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-415s1c1
Sequence:CCGGGCGTGGCACTAACTTCAACTTCTCGAGAAGTTGAAGTTAGTGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-653s1c1
Sequence:CCGGGCAAATAAGATTGCGTCTGATCTCGAGATCAGACGCAATCTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-510s1c1
Sequence:CCGGGCAAAGTGAATATCGGTTCATCTCGAGATGAACCGATATTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133021
CPA2 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A2 (pancreatic)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-499s1c1
Sequence:CCGGTGGTCTAGTGAGCAAAGTGAACTCGAGTTCACTTTGCTCACTAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-1037s1c1
Sequence:CCGGGCCAAGCCAGATGACTTTAATCTCGAGATTAAAGTCATCTGGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-415s1c1
Sequence:CCGGGCGTGGCACTAACTTCAACTTCTCGAGAAGTTGAAGTTAGTGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-653s1c1
Sequence:CCGGGCAAATAAGATTGCGTCTGATCTCGAGATCAGACGCAATCTTATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133021.3-510s1c1
Sequence:CCGGGCAAAGTGAATATCGGTTCATCTCGAGATGAACCGATATTCACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks