EMAIL THIS PAGE TO A FRIEND

CPA3

carboxypeptidase A3 (mast cell)

78 Gene Product Result for
Synonyms: MC-CPA
UniProtKB ID: P15088, Q96E94
Gene ID:
Human(1359) Summary: Three different forms of human pancreatic procarboxypeptidase A have been isolated. This gene encodes a form which is obtained as a binary complex of a procarboxypeptidase A with proproteinase E and functions as a secretory granule metalloexopeptidase. [provided by RefSeq, Jan 2009]
Mouse(12873) carboxypeptidase A3, mast cell
Rat(54242) carboxypeptidase A3, mast cell
cow(528454) carboxypeptidase A3 (mast cell)
dog(485707) carboxypeptidase A3 (mast cell)
domestic cat(101082429) carboxypeptidase A3 (mast cell)
sheep(101123173) carboxypeptidase A3 (mast cell)
naked mole-rat(101715950) carboxypeptidase A3 (mast cell)
domestic guinea pig(100715728) carboxypeptidase A3 (mast cell)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001870 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007201 MISSION® esiRNA esiRNA targeting human CPA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001870 Rosetta Predictions human pricing
XM_001056211 Rosetta Predictions rat pricing
XM_001056274 Rosetta Predictions rat pricing
XM_342219 Rosetta Predictions rat pricing
NM_007753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087230 predicted 1184
2 SASI_Hs01_00087233 predicted 1013
3 SASI_Hs01_00087235 predicted 415
4 SASI_Hs01_00087236 predicted 1040
5 SASI_Hs02_00332703 predicted 444
6 SASI_Hs02_00332704 predicted 931
7 SASI_Hs02_00332705 predicted 797
8 SASI_Hs02_00332706 predicted 659
9 SASI_Hs02_00332707 predicted 461
10 SASI_Hs02_00332708 predicted 1138
11 SASI_Hs01_00087231 predicted 384
12 SASI_Hs01_00087232 predicted 278
13 SASI_Hs01_00087234 predicted 1061
14 SASI_Hs01_00087237 predicted 778
15 SASI_Hs01_00087238 predicted 899
16 SASI_Hs01_00087239 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282448 predicted 400
2 SASI_Rn02_00282449 predicted 912
3 SASI_Rn02_00282450 predicted 883
4 SASI_Rn02_00282451 predicted 1061
5 SASI_Rn02_00282452 predicted 733
6 SASI_Rn02_00282453 predicted 452
7 SASI_Rn02_00282454 predicted 773
8 SASI_Rn02_00282455 predicted 815
9 SASI_Rn02_00282456 predicted 430
10 SASI_Rn02_00282457 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282735 predicted 409
2 SASI_Rn02_00282736 predicted 1040
3 SASI_Rn02_00282737 predicted 1005
4 SASI_Rn02_00282738 predicted 1183
5 SASI_Rn02_00282739 predicted 858
6 SASI_Rn02_00282740 predicted 464
7 SASI_Rn02_00282741 predicted 901
8 SASI_Rn02_00282742 predicted 940
9 SASI_Rn02_00282743 predicted 442
10 SASI_Rn02_00282744 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393946 predicted 1029
2 SASI_Rn02_00393947 predicted 1000
3 SASI_Rn02_00393948 predicted 1093
4 SASI_Rn02_00393949 predicted 1008
5 SASI_Rn02_00393950 predicted 1046
6 SASI_Rn02_00393951 predicted 1004
7 SASI_Rn02_00393952 predicted 1094
8 SASI_Rn02_00393953 predicted 1108
9 SASI_Rn02_00393954 predicted 1121
10 SASI_Rn02_00393955 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043411 predicted 1119
2 SASI_Mm01_00043413 predicted 1208
3 SASI_Mm01_00043414 predicted 1048
4 SASI_Mm01_00043415 predicted 964
5 SASI_Mm02_00312372 predicted 357
6 SASI_Mm02_00312373 predicted 371
7 SASI_Mm01_00043416 predicted 366
8 SASI_Mm01_00043417 predicted 454
9 SASI_Mm01_00043419 predicted 1029
10 SASI_Mm02_00312374 predicted 459
11 SASI_Mm01_00043412 predicted 1056
12 SASI_Mm01_00043418 predicted 903
13 SASI_Mm01_00043420 predicted 978
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007753
CPA3 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A3 (mast cell)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007753.1-970s21c1
Sequence:CCGGCCTAACCACCAGGACCTATTGCTCGAGCAATAGGTCCTGGTGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007753.1-895s21c1
Sequence:CCGGATCAAGGCTTATATCACTTTCCTCGAGGAAAGTGATATAAGCCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007753.1-1282s1c1
Sequence:CCGGCGTGCTAATCAATGCTTGGGTCTCGAGACCCAAGCATTGATTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-1231s1c1
Sequence:CCGGGCCAAGTATATCCTCAAGAATCTCGAGATTCTTGAGGATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-463s1c1
Sequence:CCGGCCATTATATGTCCTCAAGATTCTCGAGAATCTTGAGGACATATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-177s1c1
Sequence:CCGGCCATGATATTGCTGTGAATATCTCGAGATATTCACAGCAATATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-1039s1c1
Sequence:CCGGCGTTACATCTACGGCCCAATACTCGAGTATTGGGCCGTAGATGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007753
CPA3 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A3 (mast cell)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007753.1-970s21c1
Sequence:CCGGCCTAACCACCAGGACCTATTGCTCGAGCAATAGGTCCTGGTGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007753.1-895s21c1
Sequence:CCGGATCAAGGCTTATATCACTTTCCTCGAGGAAAGTGATATAAGCCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007753.1-1282s1c1
Sequence:CCGGCGTGCTAATCAATGCTTGGGTCTCGAGACCCAAGCATTGATTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-1231s1c1
Sequence:CCGGGCCAAGTATATCCTCAAGAATCTCGAGATTCTTGAGGATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-463s1c1
Sequence:CCGGCCATTATATGTCCTCAAGATTCTCGAGAATCTTGAGGACATATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-177s1c1
Sequence:CCGGCCATGATATTGCTGTGAATATCTCGAGATATTCACAGCAATATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-1039s1c1
Sequence:CCGGCGTTACATCTACGGCCCAATACTCGAGTATTGGGCCGTAGATGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007753
CPA3 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A3 (mast cell)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007753.1-970s21c1
Sequence:CCGGCCTAACCACCAGGACCTATTGCTCGAGCAATAGGTCCTGGTGGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007753.1-895s21c1
Sequence:CCGGATCAAGGCTTATATCACTTTCCTCGAGGAAAGTGATATAAGCCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007753.1-1282s1c1
Sequence:CCGGCGTGCTAATCAATGCTTGGGTCTCGAGACCCAAGCATTGATTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-1231s1c1
Sequence:CCGGGCCAAGTATATCCTCAAGAATCTCGAGATTCTTGAGGATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-463s1c1
Sequence:CCGGCCATTATATGTCCTCAAGATTCTCGAGAATCTTGAGGACATATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-177s1c1
Sequence:CCGGCCATGATATTGCTGTGAATATCTCGAGATATTCACAGCAATATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007753.1-1039s1c1
Sequence:CCGGCGTTACATCTACGGCCCAATACTCGAGTATTGGGCCGTAGATGTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001870
CPA3 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A3 (mast cell)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001870.2-703s21c1
Sequence:CCGGGTTCAATGTTGATGGATATATCTCGAGATATATCCATCAACATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001870.2-898s21c1
Sequence:CCGGGACGAAAGCTGTCACTAATTTCTCGAGAAATTAGTGACAGCTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001870.2-1320s21c1
Sequence:CCGGGTTTGGAATAAGCCAATTAATCTCGAGATTAATTGGCTTATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1044s1c1
Sequence:CCGGCGCTACATCTATGGCCCAATACTCGAGTATTGGGCCATAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-192s1c1
Sequence:CCGGGCTGCTAATATGATGGTGGATCTCGAGATCCACCATCATATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1236s1c1
Sequence:CCGGGCCAAGTATATCCTCAAGCATCTCGAGATGCTTGAGGATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-420s1c1
Sequence:CCGGCCTGAAATGGTCTCTCGTATTCTCGAGAATACGAGAGACCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1175s1c1
Sequence:CCGGCCTTCCAGAATCCCGGATAAACTCGAGTTTATCCGGGATTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001870
CPA3 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A3 (mast cell)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001870.2-703s21c1
Sequence:CCGGGTTCAATGTTGATGGATATATCTCGAGATATATCCATCAACATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001870.2-898s21c1
Sequence:CCGGGACGAAAGCTGTCACTAATTTCTCGAGAAATTAGTGACAGCTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001870.2-1320s21c1
Sequence:CCGGGTTTGGAATAAGCCAATTAATCTCGAGATTAATTGGCTTATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1044s1c1
Sequence:CCGGCGCTACATCTATGGCCCAATACTCGAGTATTGGGCCATAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-192s1c1
Sequence:CCGGGCTGCTAATATGATGGTGGATCTCGAGATCCACCATCATATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1236s1c1
Sequence:CCGGGCCAAGTATATCCTCAAGCATCTCGAGATGCTTGAGGATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-420s1c1
Sequence:CCGGCCTGAAATGGTCTCTCGTATTCTCGAGAATACGAGAGACCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1175s1c1
Sequence:CCGGCCTTCCAGAATCCCGGATAAACTCGAGTTTATCCGGGATTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001870
CPA3 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A3 (mast cell)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001870.2-703s21c1
Sequence:CCGGGTTCAATGTTGATGGATATATCTCGAGATATATCCATCAACATTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001870.2-898s21c1
Sequence:CCGGGACGAAAGCTGTCACTAATTTCTCGAGAAATTAGTGACAGCTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001870.2-1320s21c1
Sequence:CCGGGTTTGGAATAAGCCAATTAATCTCGAGATTAATTGGCTTATTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1044s1c1
Sequence:CCGGCGCTACATCTATGGCCCAATACTCGAGTATTGGGCCATAGATGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-192s1c1
Sequence:CCGGGCTGCTAATATGATGGTGGATCTCGAGATCCACCATCATATTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1236s1c1
Sequence:CCGGGCCAAGTATATCCTCAAGCATCTCGAGATGCTTGAGGATATACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-420s1c1
Sequence:CCGGCCTGAAATGGTCTCTCGTATTCTCGAGAATACGAGAGACCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001870.1-1175s1c1
Sequence:CCGGCCTTCCAGAATCCCGGATAAACTCGAGTTTATCCGGGATTCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks