EMAIL THIS PAGE TO A FRIEND

CPA4

carboxypeptidase A4

112 Gene Product Result for
Synonyms: CPA3
UniProtKB ID: Q9UI42, B7Z576, Q86UY9
Gene ID:
Human(51200) Summary: This gene is a member of the carboxypeptidase A/B subfamily, and it is located in a cluster with three other family members on chromosome 7. Carboxypeptidases are zinc-containing exopeptidases that catalyze the release of carboxy-terminal amino acids, and are synthesized as zymogens that are activated by proteolytic cleavage. This gene could be involved in the histone hyperacetylation pathway. It is imprinted and may be a strong candidate gene for prostate cancer aggressiveness. [provided by RefSeq, Jul 2008]
Mouse(71791) carboxypeptidase A4
Rat(502736) carboxypeptidase A4
domestic guinea pig(100722008) carboxypeptidase A4
naked mole-rat(101717700) carboxypeptidase A4
sheep(101116474) carboxypeptidase A4
Domestic Rabbit(100340827) carboxypeptidase A4
Zebrafish(431764) carboxypeptidase A4
cow(512903) carboxypeptidase A4
cow(101903481) carboxypeptidase A4
domestic cat(101089089) carboxypeptidase A4
Horse(100057135) carboxypeptidase A4
dog(482258) carboxypeptidase A4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016352 Rosetta Predictions human pricing
NM_001109346 Rosetta Predictions rat pricing
NM_027926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103087 predicted 464
2 SASI_Hs01_00103088 predicted 1131
3 SASI_Hs01_00103089 predicted 425
4 SASI_Hs01_00103090 predicted 613
5 SASI_Hs01_00103091 predicted 966
6 SASI_Hs01_00103093 predicted 465
7 SASI_Hs02_00349314 predicted 403
8 SASI_Hs01_00103094 predicted 1136
9 SASI_Hs01_00103095 predicted 644
10 SASI_Hs01_00103096 predicted 1300
11 SASI_Hs01_00103092 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247524 predicted 1139
2 SASI_Rn02_00247525 predicted 601
3 SASI_Rn02_00247526 predicted 1319
4 SASI_Rn02_00247527 predicted 1132
5 SASI_Rn02_00247528 predicted 397
6 SASI_Rn02_00247529 predicted 759
7 SASI_Rn02_00247530 predicted 881
8 SASI_Rn02_00247531 predicted 815
9 SASI_Rn02_00247532 predicted 1271
10 SASI_Rn02_00247533 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332906 predicted 1266
2 SASI_Mm01_00103492 predicted 752
3 SASI_Mm01_00103493 predicted 1134
4 SASI_Mm01_00103494 predicted 1072
5 SASI_Mm01_00103495 predicted 1169
6 SASI_Mm01_00103496 predicted 644
7 SASI_Mm01_00103497 predicted 689
8 SASI_Mm01_00103498 predicted 203
9 SASI_Mm01_00103499 predicted 820
10 SASI_Mm01_00103500 predicted 594
11 SASI_Mm01_00103501 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027926
CPA4 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-598s1c1
Sequence:CCGGGCGAGGAAGATTGTAACTGATCTCGAGATCAGTTACAATCTTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-1136s1c1
Sequence:CCGGGCATCAAGTATGCTTTCACATCTCGAGATGTGAAAGCATACTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-714s1c1
Sequence:CCGGCCAGAACCGATTATGGAGAAACTCGAGTTTCTCCATAATCGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-906s1c1
Sequence:CCGGGCATGGGAACTTCAAATGCTTCTCGAGAAGCATTTGAAGTTCCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-483s1c1
Sequence:CCGGGCCCATGTATGTTCTAAAGTTCTCGAGAACTTTAGAACATACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027926
CPA4 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-598s1c1
Sequence:CCGGGCGAGGAAGATTGTAACTGATCTCGAGATCAGTTACAATCTTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-1136s1c1
Sequence:CCGGGCATCAAGTATGCTTTCACATCTCGAGATGTGAAAGCATACTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-714s1c1
Sequence:CCGGCCAGAACCGATTATGGAGAAACTCGAGTTTCTCCATAATCGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-906s1c1
Sequence:CCGGGCATGGGAACTTCAAATGCTTCTCGAGAAGCATTTGAAGTTCCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-483s1c1
Sequence:CCGGGCCCATGTATGTTCTAAAGTTCTCGAGAACTTTAGAACATACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027926
CPA4 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-598s1c1
Sequence:CCGGGCGAGGAAGATTGTAACTGATCTCGAGATCAGTTACAATCTTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-1136s1c1
Sequence:CCGGGCATCAAGTATGCTTTCACATCTCGAGATGTGAAAGCATACTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-714s1c1
Sequence:CCGGCCAGAACCGATTATGGAGAAACTCGAGTTTCTCCATAATCGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-906s1c1
Sequence:CCGGGCATGGGAACTTCAAATGCTTCTCGAGAAGCATTTGAAGTTCCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027926.1-483s1c1
Sequence:CCGGGCCCATGTATGTTCTAAAGTTCTCGAGAACTTTAGAACATACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016352
VALIDATED
CPA4 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-1115s1c1
Sequence:CCGGGCGTATGACAACGGCATCAAACTCGAGTTTGATGCCGTTGTCATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-346s1c1
Sequence:CCGGGAGCAGTAATAACTTCAACTACTCGAGTAGTTGAAGTTATTACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-1128s1c1
Sequence:CCGGGCATCAAATTTGCATTCACATCTCGAGATGTGAATGCAAATTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-475s1c1
Sequence:CCGGGCCGATGTATGTACTGAAGTTCTCGAGAACTTCAGTACATACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-258s1c1
Sequence:CCGGGCTTAGAGTACGCAGTGACAACTCGAGTTGTCACTGCGTACTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-386s21c1
Sequence:CCGGGAGCAGTAATAACTTCAACTACTCGAGTAGTTGAAGTTATTACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-515s21c1
Sequence:CCGGGCCGATGTATGTACTGAAGTTCTCGAGAACTTCAGTACATACATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-1155s21c1
Sequence:CCGGGCGTATGACAACGGCATCAAACTCGAGTTTGATGCCGTTGTCATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-298s21c1
Sequence:CCGGGCTTAGAGTACGCAGTGACAACTCGAGTTGTCACTGCGTACTCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-1168s21c1
Sequence:CCGGGCATCAAATTTGCATTCACATCTCGAGATGTGAATGCAAATTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016352
VALIDATED
CPA4 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-1115s1c1
Sequence:CCGGGCGTATGACAACGGCATCAAACTCGAGTTTGATGCCGTTGTCATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-346s1c1
Sequence:CCGGGAGCAGTAATAACTTCAACTACTCGAGTAGTTGAAGTTATTACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-1128s1c1
Sequence:CCGGGCATCAAATTTGCATTCACATCTCGAGATGTGAATGCAAATTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-475s1c1
Sequence:CCGGGCCGATGTATGTACTGAAGTTCTCGAGAACTTCAGTACATACATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-258s1c1
Sequence:CCGGGCTTAGAGTACGCAGTGACAACTCGAGTTGTCACTGCGTACTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-386s21c1
Sequence:CCGGGAGCAGTAATAACTTCAACTACTCGAGTAGTTGAAGTTATTACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-515s21c1
Sequence:CCGGGCCGATGTATGTACTGAAGTTCTCGAGAACTTCAGTACATACATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-1155s21c1
Sequence:CCGGGCGTATGACAACGGCATCAAACTCGAGTTTGATGCCGTTGTCATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-298s21c1
Sequence:CCGGGCTTAGAGTACGCAGTGACAACTCGAGTTGTCACTGCGTACTCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-1168s21c1
Sequence:CCGGGCATCAAATTTGCATTCACATCTCGAGATGTGAATGCAAATTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016352
VALIDATED
CPA4 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-1115s1c1
Sequence:CCGGGCGTATGACAACGGCATCAAACTCGAGTTTGATGCCGTTGTCATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-346s1c1
Sequence:CCGGGAGCAGTAATAACTTCAACTACTCGAGTAGTTGAAGTTATTACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-1128s1c1
Sequence:CCGGGCATCAAATTTGCATTCACATCTCGAGATGTGAATGCAAATTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-475s1c1
Sequence:CCGGGCCGATGTATGTACTGAAGTTCTCGAGAACTTCAGTACATACATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_016352.1-258s1c1
Sequence:CCGGGCTTAGAGTACGCAGTGACAACTCGAGTTGTCACTGCGTACTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-386s21c1
Sequence:CCGGGAGCAGTAATAACTTCAACTACTCGAGTAGTTGAAGTTATTACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-515s21c1
Sequence:CCGGGCCGATGTATGTACTGAAGTTCTCGAGAACTTCAGTACATACATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-1155s21c1
Sequence:CCGGGCGTATGACAACGGCATCAAACTCGAGTTTGATGCCGTTGTCATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-298s21c1
Sequence:CCGGGCTTAGAGTACGCAGTGACAACTCGAGTTGTCACTGCGTACTCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016352.3-1168s21c1
Sequence:CCGGGCATCAAATTTGCATTCACATCTCGAGATGTGAATGCAAATTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)