EMAIL THIS PAGE TO A FRIEND

CPA5

carboxypeptidase A5

78 Gene Product Result for
UniProtKB ID: Q8WXQ8, G3V0G8, Q6ZNI6, Q86SE2, Q86XM3, Q8NA08
Gene ID:
Human(93979) Summary: Carboxypeptidases have functions ranging from digestion of food to selective biosynthesis of neuroendocrine peptides. Members of the A/B subfamily of carboxypeptidases, such as CPA5, contain an approximately 90-amino acid pro region that assists in the folding of the active carboxypeptidase domain. Cleavage of the pro region activates the enzyme (Wei et al., 2002 [PubMed 11836249]
Mouse(74649) carboxypeptidase A5
Rat(408212) carboxypeptidase A5
Zebrafish(246092) carboxypeptidase A5
cow(511416) carboxypeptidase A5
Horse(100071982) carboxypeptidase A5
domestic cat(101089507) carboxypeptidase A5
dog(482257) carboxypeptidase A5
chicken(416683) carboxypeptidase A5
sheep(101116902) carboxypeptidase A5
naked mole-rat(101699746) carboxypeptidase A5
domestic guinea pig(100735765) carboxypeptidase A5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080385 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140251 MISSION® esiRNA esiRNA human CPA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127441 Rosetta Predictions human pricing
NM_001127442 Rosetta Predictions human pricing
NM_080385 Rosetta Predictions human pricing
NM_001002808 Rosetta Predictions rat pricing
NM_144537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329494 predicted 918
2 SASI_Hs02_00329495 predicted 1077
3 SASI_Hs02_00329496 predicted 1248
4 SASI_Hs02_00329497 predicted 1301
5 SASI_Hs02_00329498 predicted 1050
6 SASI_Hs02_00329499 predicted 917
7 SASI_Hs02_00329500 predicted 880
8 SASI_Hs02_00329501 predicted 1276
9 SASI_Hs02_00329502 predicted 850
10 SASI_Hs02_00329503 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329504 predicted 804
2 SASI_Hs02_00329505 predicted 969
3 SASI_Hs02_00329506 predicted 1128
4 SASI_Hs02_00329507 predicted 1194
5 SASI_Hs02_00329508 predicted 941
6 SASI_Hs02_00329509 predicted 804
7 SASI_Hs02_00329510 predicted 770
8 SASI_Hs02_00329511 predicted 1169
9 SASI_Hs02_00329512 predicted 744
10 SASI_Hs02_00329513 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232477 predicted 866
2 SASI_Hs02_00362213 predicted 1024
3 SASI_Hs01_00232479 predicted 1189
4 SASI_Hs02_00362214 predicted 1251
5 SASI_Hs02_00362215 predicted 999
6 SASI_Hs01_00232481 predicted 863
7 SASI_Hs01_00232483 predicted 827
8 SASI_Hs02_00362216 predicted 1225
9 SASI_Hs01_00232484 predicted 804
10 SASI_Hs02_00362217 predicted 1181
11 SASI_Hs01_00232478 predicted 1848
12 SASI_Hs01_00232480 predicted 1490
13 SASI_Hs01_00232482 predicted 1762
14 SASI_Hs01_00232485 predicted 1580
15 SASI_Hs01_00232486 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032691 predicted 1039
2 SASI_Rn02_00197995 predicted 1814
3 SASI_Rn01_00032693 predicted 1463
4 SASI_Rn01_00032694 predicted 981
5 SASI_Rn01_00032695 predicted 879
6 SASI_Rn01_00032696 predicted 1149
7 SASI_Rn01_00032697 predicted 664
8 SASI_Rn01_00032698 predicted 1136
9 SASI_Rn01_00032699 predicted 1763
10 SASI_Rn01_00032700 predicted 1762
11 SASI_Rn01_00032692 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158469 predicted 1190
2 SASI_Mm01_00158470 predicted 1441
3 SASI_Mm01_00158471 predicted 1264
4 SASI_Mm01_00158472 predicted 916
5 SASI_Mm01_00158473 predicted 1579
6 SASI_Mm01_00158474 predicted 1509
7 SASI_Mm02_00340070 predicted 581
8 SASI_Mm01_00158475 predicted 1264
9 SASI_Mm01_00158476 predicted 988
10 SASI_Mm01_00158477 predicted 1680
11 SASI_Mm01_00158478 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144537
CPA5 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144537.3-1267s21c1
Sequence:CCGGCTCATAGCATGAACCGCTTATCTCGAGATAAGCGGTTCATGCTATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144537.3-1637s21c1
Sequence:CCGGCATCAGCACCACCCTCTATTCCTCGAGGAATAGAGGGTGGTGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1365s1c1
Sequence:CCGGCGGAGGAAATGGTTCTAACAACTCGAGTTGTTAGAACCATTTCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-798s1c1
Sequence:CCGGGCCCAGTGTTAAAGCTTATTTCTCGAGAAATAAGCTTTAACACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1794s1c1
Sequence:CCGGGATGGCATTACAGACCATCATCTCGAGATGATGGTCTGTAATGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-601s1c1
Sequence:CCGGTGCAACTTTATCTTGGCTGTACTCGAGTACAGCCAAGATAAAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1191s1c1
Sequence:CCGGCCATGTCTTGAAGAGGATATTCTCGAGAATATCCTCTTCAAGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144537
CPA5 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144537.3-1267s21c1
Sequence:CCGGCTCATAGCATGAACCGCTTATCTCGAGATAAGCGGTTCATGCTATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144537.3-1637s21c1
Sequence:CCGGCATCAGCACCACCCTCTATTCCTCGAGGAATAGAGGGTGGTGCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1365s1c1
Sequence:CCGGCGGAGGAAATGGTTCTAACAACTCGAGTTGTTAGAACCATTTCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-798s1c1
Sequence:CCGGGCCCAGTGTTAAAGCTTATTTCTCGAGAAATAAGCTTTAACACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1794s1c1
Sequence:CCGGGATGGCATTACAGACCATCATCTCGAGATGATGGTCTGTAATGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-601s1c1
Sequence:CCGGTGCAACTTTATCTTGGCTGTACTCGAGTACAGCCAAGATAAAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1191s1c1
Sequence:CCGGCCATGTCTTGAAGAGGATATTCTCGAGAATATCCTCTTCAAGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144537
CPA5 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144537.3-1267s21c1
Sequence:CCGGCTCATAGCATGAACCGCTTATCTCGAGATAAGCGGTTCATGCTATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144537.3-1637s21c1
Sequence:CCGGCATCAGCACCACCCTCTATTCCTCGAGGAATAGAGGGTGGTGCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1365s1c1
Sequence:CCGGCGGAGGAAATGGTTCTAACAACTCGAGTTGTTAGAACCATTTCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-798s1c1
Sequence:CCGGGCCCAGTGTTAAAGCTTATTTCTCGAGAAATAAGCTTTAACACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1794s1c1
Sequence:CCGGGATGGCATTACAGACCATCATCTCGAGATGATGGTCTGTAATGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-601s1c1
Sequence:CCGGTGCAACTTTATCTTGGCTGTACTCGAGTACAGCCAAGATAAAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144537.1-1191s1c1
Sequence:CCGGCCATGTCTTGAAGAGGATATTCTCGAGAATATCCTCTTCAAGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080385
CPA5 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080385.4-964s21c1
Sequence:CCGGAGCTTCAGTTACTCATCATACCTCGAGGTATGATGAGTAACTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080385.4-1304s21c1
Sequence:CCGGCCCACAGCATGAACCGCTTATCTCGAGATAAGCGGTTCATGCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1764s1c1
Sequence:CCGGGCCAATAAGATTGTCAGTGATCTCGAGATCACTGACAATCTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1601s1c1
Sequence:CCGGGCATTCCGATATTGTCTCAAACTCGAGTTTGAGACAATATCGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1896s1c1
Sequence:CCGGCGGAAGAACAAGTCCATCAGACTCGAGTCTGATGGACTTGTTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1372s1c1
Sequence:CCGGCTGTGGATATGAGAGTTCCTTCTCGAGAAGGAACTCTCATATCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-2153s1c1
Sequence:CCGGCGTTTCAAATCAGAGGGAGTTCTCGAGAACTCCCTCTGATTTGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080385
CPA5 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080385.4-964s21c1
Sequence:CCGGAGCTTCAGTTACTCATCATACCTCGAGGTATGATGAGTAACTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080385.4-1304s21c1
Sequence:CCGGCCCACAGCATGAACCGCTTATCTCGAGATAAGCGGTTCATGCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1764s1c1
Sequence:CCGGGCCAATAAGATTGTCAGTGATCTCGAGATCACTGACAATCTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1601s1c1
Sequence:CCGGGCATTCCGATATTGTCTCAAACTCGAGTTTGAGACAATATCGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1896s1c1
Sequence:CCGGCGGAAGAACAAGTCCATCAGACTCGAGTCTGATGGACTTGTTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1372s1c1
Sequence:CCGGCTGTGGATATGAGAGTTCCTTCTCGAGAAGGAACTCTCATATCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-2153s1c1
Sequence:CCGGCGTTTCAAATCAGAGGGAGTTCTCGAGAACTCCCTCTGATTTGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080385
CPA5 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080385.4-964s21c1
Sequence:CCGGAGCTTCAGTTACTCATCATACCTCGAGGTATGATGAGTAACTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080385.4-1304s21c1
Sequence:CCGGCCCACAGCATGAACCGCTTATCTCGAGATAAGCGGTTCATGCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1764s1c1
Sequence:CCGGGCCAATAAGATTGTCAGTGATCTCGAGATCACTGACAATCTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1601s1c1
Sequence:CCGGGCATTCCGATATTGTCTCAAACTCGAGTTTGAGACAATATCGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1896s1c1
Sequence:CCGGCGGAAGAACAAGTCCATCAGACTCGAGTCTGATGGACTTGTTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-1372s1c1
Sequence:CCGGCTGTGGATATGAGAGTTCCTTCTCGAGAAGGAACTCTCATATCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080385.2-2153s1c1
Sequence:CCGGCGTTTCAAATCAGAGGGAGTTCTCGAGAACTCCCTCTGATTTGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)