EMAIL THIS PAGE TO A FRIEND

CPA6

carboxypeptidase A6

65 Gene Product Result for
Synonyms: CPAH ETL5 FEB11
UniProtKB ID: Q8N4T0, Q8NEX8, Q8TDE8, Q9NRI9
Gene ID:
Human(57094) Summary: The protein encoded by this gene belongs to the family of carboxypeptidases, which catalyze the release of C-terminal amino acid, and have functions ranging from digestion of food to selective biosynthesis of neuroendocrine peptides. Polymorphic variants and a reciprocal translocation t(6;8)(q26;q13) involving this gene, have been associated with Duane retraction syndrome.[provided by RefSeq, Sep 2010]
Mouse(329093) carboxypeptidase A6
Rat(312913) carboxypeptidase A6
domestic guinea pig(100716045) carboxypeptidase A6
naked mole-rat(101708498) carboxypeptidase A6
sheep(101102739) carboxypeptidase A6
Domestic Rabbit(100345666) carboxypeptidase A6
chicken(420171) carboxypeptidase A6
cow(100337371) carboxypeptidase A6
Horse(100063218) carboxypeptidase A6
domestic cat(101093080) carboxypeptidase A6
dog(486983) carboxypeptidase A6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127445 Rosetta Predictions human pricing
NM_020361 Rosetta Predictions human pricing
NM_001107900 Rosetta Predictions rat pricing
NM_177834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329534 predicted 1196
2 SASI_Hs02_00329535 predicted 700
3 SASI_Hs02_00329536 predicted 1252
4 SASI_Hs02_00329537 predicted 1197
5 SASI_Hs02_00329538 predicted 1240
6 SASI_Hs02_00329539 predicted 659
7 SASI_Hs02_00329540 predicted 669
8 SASI_Hs02_00329541 predicted 1202
9 SASI_Hs02_00329542 predicted 684
10 SASI_Hs02_00329543 predicted 1173
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010771 predicted 1609
2 SASI_Hs01_00010773 predicted 816
3 SASI_Hs01_00010777 predicted 1664
4 SASI_Hs02_00353299 predicted 1615
5 SASI_Hs02_00353300 predicted 1651
6 SASI_Hs02_00353301 predicted 784
7 SASI_Hs02_00353302 predicted 791
8 SASI_Hs02_00353303 predicted 1622
9 SASI_Hs02_00353304 predicted 813
10 SASI_Hs02_00353305 predicted 1591
11 SASI_Hs01_00010772 predicted 1156
12 SASI_Hs01_00010774 predicted 600
13 SASI_Hs01_00010775 predicted 430
14 SASI_Hs01_00010776 predicted 437
15 SASI_Hs01_00010778 predicted 341
16 SASI_Hs01_00010779 predicted 1408
17 SASI_Hs01_00010780 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233385 predicted 819
2 SASI_Rn02_00233386 predicted 1063
3 SASI_Rn02_00233387 predicted 796
4 SASI_Rn02_00233388 predicted 482
5 SASI_Rn02_00233389 predicted 444
6 SASI_Rn02_00233390 predicted 808
7 SASI_Rn02_00233391 predicted 1177
8 SASI_Rn02_00233392 predicted 921
9 SASI_Rn02_00233393 predicted 1188
10 SASI_Rn02_00233394 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102945 predicted 968
2 SASI_Mm01_00102946 predicted 592
3 SASI_Mm01_00102947 predicted 444
4 SASI_Mm01_00102948 predicted 1198
5 SASI_Mm02_00348297 predicted 384
6 SASI_Mm01_00102949 predicted 983
7 SASI_Mm01_00102950 predicted 1357
8 SASI_Mm01_00102951 predicted 627
9 SASI_Mm01_00102952 predicted 1341
10 SASI_Mm01_00102953 predicted 535
11 SASI_Mm01_00102954 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177834
CPA6 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-866s1c1
Sequence:CCGGCGGTCAAGAGACTCTAAGTTTCTCGAGAAACTTAGAGTCTCTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1079s1c1
Sequence:CCGGCAGATGTTGCTATATCCTTATCTCGAGATAAGGATATAGCAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-840s1c1
Sequence:CCGGCACATGATAGATTCTGGAGAACTCGAGTTCTCCAGAATCTATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1322s1c1
Sequence:CCGGCTGCCAGAGATGCTCATTAAACTCGAGTTTAATGAGCATCTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1208s1c1
Sequence:CCGGGCCTCCCAAACACTGTATGTACTCGAGTACATACAGTGTTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177834
CPA6 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-866s1c1
Sequence:CCGGCGGTCAAGAGACTCTAAGTTTCTCGAGAAACTTAGAGTCTCTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1079s1c1
Sequence:CCGGCAGATGTTGCTATATCCTTATCTCGAGATAAGGATATAGCAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-840s1c1
Sequence:CCGGCACATGATAGATTCTGGAGAACTCGAGTTCTCCAGAATCTATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1322s1c1
Sequence:CCGGCTGCCAGAGATGCTCATTAAACTCGAGTTTAATGAGCATCTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1208s1c1
Sequence:CCGGGCCTCCCAAACACTGTATGTACTCGAGTACATACAGTGTTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177834
CPA6 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-866s1c1
Sequence:CCGGCGGTCAAGAGACTCTAAGTTTCTCGAGAAACTTAGAGTCTCTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1079s1c1
Sequence:CCGGCAGATGTTGCTATATCCTTATCTCGAGATAAGGATATAGCAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-840s1c1
Sequence:CCGGCACATGATAGATTCTGGAGAACTCGAGTTCTCCAGAATCTATCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1322s1c1
Sequence:CCGGCTGCCAGAGATGCTCATTAAACTCGAGTTTAATGAGCATCTCTGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177834.2-1208s1c1
Sequence:CCGGGCCTCCCAAACACTGTATGTACTCGAGTACATACAGTGTTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020361
CPA6 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase A6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-424s1c1
Sequence:CCGGCCCAGCAGTATCTCCTATGTACTCGAGTACATAGGAGATACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-306s1c1
Sequence:CCGGCCACCTTTATAACAACCGCTACTCGAGTAGCGGTTGTTATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-781s1c1
Sequence:CCGGGTTTGGATAGACTGTGGTATTCTCGAGAATACCACAGTCTATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-1198s1c1
Sequence:CCGGCAGATGTTACTGTATCCCTATCTCGAGATAGGGATACAGTAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-1349s1c1
Sequence:CCGGGCTCTGGTAGCTCAATGGATTCTCGAGAATCCATTGAGCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-371s21c1
Sequence:CCGGGGTGATAAAGTGATAAGATTTCTCGAGAAATCTTATCACTTTATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-1450s21c1
Sequence:CCGGACTACGTGACACTGGATATTTCTCGAGAAATATCCAGTGTCACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-641s21c1
Sequence:CCGGAGATCCCTCTCTGGATATAATCTCGAGATTATATCCAGAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020361
CPA6 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase A6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-424s1c1
Sequence:CCGGCCCAGCAGTATCTCCTATGTACTCGAGTACATAGGAGATACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-306s1c1
Sequence:CCGGCCACCTTTATAACAACCGCTACTCGAGTAGCGGTTGTTATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-781s1c1
Sequence:CCGGGTTTGGATAGACTGTGGTATTCTCGAGAATACCACAGTCTATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-1198s1c1
Sequence:CCGGCAGATGTTACTGTATCCCTATCTCGAGATAGGGATACAGTAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-1349s1c1
Sequence:CCGGGCTCTGGTAGCTCAATGGATTCTCGAGAATCCATTGAGCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-371s21c1
Sequence:CCGGGGTGATAAAGTGATAAGATTTCTCGAGAAATCTTATCACTTTATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-1450s21c1
Sequence:CCGGACTACGTGACACTGGATATTTCTCGAGAAATATCCAGTGTCACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-641s21c1
Sequence:CCGGAGATCCCTCTCTGGATATAATCTCGAGATTATATCCAGAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020361
CPA6 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase A6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-424s1c1
Sequence:CCGGCCCAGCAGTATCTCCTATGTACTCGAGTACATAGGAGATACTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-306s1c1
Sequence:CCGGCCACCTTTATAACAACCGCTACTCGAGTAGCGGTTGTTATAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-781s1c1
Sequence:CCGGGTTTGGATAGACTGTGGTATTCTCGAGAATACCACAGTCTATCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-1198s1c1
Sequence:CCGGCAGATGTTACTGTATCCCTATCTCGAGATAGGGATACAGTAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020361.2-1349s1c1
Sequence:CCGGGCTCTGGTAGCTCAATGGATTCTCGAGAATCCATTGAGCTACCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-371s21c1
Sequence:CCGGGGTGATAAAGTGATAAGATTTCTCGAGAAATCTTATCACTTTATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-1450s21c1
Sequence:CCGGACTACGTGACACTGGATATTTCTCGAGAAATATCCAGTGTCACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020361.4-641s21c1
Sequence:CCGGAGATCCCTCTCTGGATATAATCTCGAGATTATATCCAGAGAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks