EMAIL THIS PAGE TO A FRIEND

CPAMD8

C3 and PZP-like, alpha-2-macroglobulin domain containing 8

93 Gene Product Result for
Synonyms: K-CAP VIP
UniProtKB ID: Q8IZJ3, Q8NC09, Q9ULD7
Gene ID:
Human(27151) Summary: CPAMD8 belongs to the complement component-3 (C3; MIM 120700)/alpha-2-macroglobulin (A2M; MIM 103950) family of proteins, which are involved in innate immunity and damage control. Complement components recognize and eliminate pathogens by direct binding or by mediating opsonization/phagocytosis and intracellular killing, and A2M is a broad-spectrum protease inhibitor (Li et al., 2004 [PubMed 15177561]
Rat(297572) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
Zebrafish(564182) C3 and PZP-like alpha-2-macroglobulin domain-containing protein 8
Zebrafish(100151400) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
cow(100298265) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
domestic cat(101081279) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
dog(484845) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
chicken(420138) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
sheep(101116142) C3 and PZP-like, alpha-2-macroglobulin domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015692 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148461 MISSION® esiRNA esiRNA human CPAMD8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015692 Rosetta Predictions human pricing
XM_001060284 Rosetta Predictions rat pricing
XM_213006 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121086 predicted 3622
2 SASI_Hs01_00121087 predicted 404
3 SASI_Hs02_00348345 predicted 4048
4 SASI_Hs01_00121088 predicted 2018
5 SASI_Hs02_00348346 predicted 1316
6 SASI_Hs01_00121092 predicted 966
7 SASI_Hs01_00121090 predicted 2420
8 SASI_Hs01_00121091 predicted 695
9 SASI_Hs01_00121093 predicted 701
10 SASI_Hs02_00348347 predicted 2435
11 SASI_Hs01_00121089 predicted 1945
12 SASI_Hs01_00121094 predicted 1182
13 SASI_Hs01_00121095 predicted 3095
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295898 predicted 1317
2 SASI_Rn02_00295899 predicted 896
3 SASI_Rn02_00295900 predicted 1990
4 SASI_Rn02_00295901 predicted 1314
5 SASI_Rn02_00295902 predicted 1941
6 SASI_Rn02_00295903 predicted 3413
7 SASI_Rn02_00295904 predicted 2110
8 SASI_Rn02_00295905 predicted 983
9 SASI_Rn02_00295906 predicted 3415
10 SASI_Rn02_00295907 predicted 3730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374375 predicted 1313
2 SASI_Rn02_00374376 predicted 891
3 SASI_Rn02_00374377 predicted 1994
4 SASI_Rn02_00374378 predicted 1316
5 SASI_Rn02_00374379 predicted 1938
6 SASI_Rn02_00374380 predicted 2109
7 SASI_Rn02_00374381 predicted 985
8 SASI_Rn02_00374382 predicted 4595
9 SASI_Rn02_00374383 predicted 149
10 SASI_Rn02_00374384 predicted 3418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015692
CPAMD8 MISSION shRNA Bacterial Glycerol Stock
C3 and PZP-like, alpha-2-macroglobulin domain containing 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-2687s1c1
Sequence:CCGGCCTTGCTTACGGAGACACAAACTCGAGTTTGTGTCTCCGTAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-253s1c1
Sequence:CCGGCCATCCTGGATAAAGGGACAACTCGAGTTGTCCCTTTATCCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-4654s1c1
Sequence:CCGGCCGATCAGCATCACCAGGAATCTCGAGATTCCTGGTGATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-3110s1c1
Sequence:CCGGCTGGGATGAATTCAGAACATTCTCGAGAATGTTCTGAATTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-2259s1c1
Sequence:CCGGCCCGAAACATGGATTTGGCATCTCGAGATGCCAAATCCATGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015692
CPAMD8 MISSION shRNA shRNA Plasmid DNA
C3 and PZP-like, alpha-2-macroglobulin domain containing 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-2687s1c1
Sequence:CCGGCCTTGCTTACGGAGACACAAACTCGAGTTTGTGTCTCCGTAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-253s1c1
Sequence:CCGGCCATCCTGGATAAAGGGACAACTCGAGTTGTCCCTTTATCCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-4654s1c1
Sequence:CCGGCCGATCAGCATCACCAGGAATCTCGAGATTCCTGGTGATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-3110s1c1
Sequence:CCGGCTGGGATGAATTCAGAACATTCTCGAGAATGTTCTGAATTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-2259s1c1
Sequence:CCGGCCCGAAACATGGATTTGGCATCTCGAGATGCCAAATCCATGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015692
CPAMD8 MISSION shRNA Lentiviral Transduction Particles
C3 and PZP-like, alpha-2-macroglobulin domain containing 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-2687s1c1
Sequence:CCGGCCTTGCTTACGGAGACACAAACTCGAGTTTGTGTCTCCGTAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-253s1c1
Sequence:CCGGCCATCCTGGATAAAGGGACAACTCGAGTTGTCCCTTTATCCAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-4654s1c1
Sequence:CCGGCCGATCAGCATCACCAGGAATCTCGAGATTCCTGGTGATGCTGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-3110s1c1
Sequence:CCGGCTGGGATGAATTCAGAACATTCTCGAGAATGTTCTGAATTCATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015692.1-2259s1c1
Sequence:CCGGCCCGAAACATGGATTTGGCATCTCGAGATGCCAAATCCATGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks