EMAIL THIS PAGE TO A FRIEND

CPB1

carboxypeptidase B1 (tissue)

Synonyms: CPB PASP PCPB
UniProtKB ID: P15086, O60834, Q53XJ0, Q96BQ8
Gene ID:
Human(1360) Summary: Three different procarboxypeptidases A and two different procarboxypeptidases B have been isolated. The B1 and B2 forms differ from each other mainly in isoelectric point. Carboxypeptidase B1 is a highly tissue-specific protein and is a useful serum marker for acute pancreatitis and dysfunction of pancreatic transplants. It is not elevated in pancreatic carcinoma. [provided by RefSeq, Jul 2008]
Mouse(76703) carboxypeptidase B1 (tissue)
Rat(24271) carboxypeptidase B1 (tissue)
Zebrafish(322412) carboxypeptidase B1 (tissue)
cow(510039) carboxypeptidase B1 (tissue)
Horse(100058959) carboxypeptidase B1 (tissue)
domestic cat(101082684) carboxypeptidase B1 (tissue)
dog(403512) carboxypeptidase B1 (tissue)
chicken(424888) carboxypeptidase B1 (tissue)
domestic guinea pig(100716012) carboxypeptidase B1 (tissue)
naked mole-rat(101715608) carboxypeptidase B1 (tissue)
sheep(101123433) carboxypeptidase B1 (tissue)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B8011 DL-Benzylsuccinic acid ≥99% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001871 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001871 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001871 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_130814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019711 MISSION® esiRNA esiRNA human CPB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001871 Rosetta Predictions human pricing
NM_012533 Rosetta Predictions rat pricing
NM_029706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033632 predicted 606
2 SASI_Hs01_00033633 predicted 936
3 SASI_Hs01_00033634 predicted 211
4 SASI_Hs01_00033635 predicted 460
5 SASI_Hs01_00033636 predicted 310
6 SASI_Hs02_00332709 predicted 1161
7 SASI_Hs01_00033637 predicted 983
8 SASI_Hs01_00033638 predicted 948
9 SASI_Hs01_00033640 predicted 443
10 SASI_Hs01_00033641 predicted 371
11 SASI_Hs01_00033639 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012533 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043451 predicted 724
2 SASI_Rn01_00043452 predicted 392
3 SASI_Rn01_00043453 predicted 898
4 SASI_Rn01_00043454 predicted 847
5 SASI_Rn01_00043455 predicted 377
6 SASI_Rn01_00043456 predicted 494
7 SASI_Rn02_00259610 predicted 954
8 SASI_Rn01_00043457 predicted 623
9 SASI_Rn01_00043458 predicted 269
10 SASI_Rn01_00043459 predicted 357
11 SASI_Rn01_00043460 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125611 predicted 460
2 SASI_Mm01_00125612 predicted 343
3 SASI_Mm01_00125613 predicted 244
4 SASI_Mm01_00125614 predicted 325
5 SASI_Mm01_00125615 predicted 232
6 SASI_Mm01_00125616 predicted 676
7 SASI_Mm02_00335763 predicted 875
8 SASI_Mm01_00125618 predicted 415
9 SASI_Mm01_00125619 predicted 1264
10 SASI_Mm02_00335764 predicted 1199
11 SASI_Mm01_00125617 predicted 433
12 SASI_Mm01_00125620 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001871
CPB1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase B1 (tissue)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-879s1c1
Sequence:CCGGGCTGATTTCATCCGCAACAAACTCGAGTTTGTTGCGGATGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-941s1c1
Sequence:CCGGCCAAATGATGATCTACCCTTACTCGAGTAAGGGTAGATCATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-448s1c1
Sequence:CCGGGCAGTGTTATCGGAACCACATCTCGAGATGTGGTTCCGATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-185s1c1
Sequence:CCGGGCCAGATTCTGTCACACAAATCTCGAGATTTGTGTGACAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-1124s1c1
Sequence:CCGGCCAAGGAATCAGATATTCCTTCTCGAGAAGGAATATCTGATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-662s21c1
Sequence:CCGGTGTCCTGCCTGTGCTCAATATCTCGAGATATTGAGCACAGGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-95s21c1
Sequence:CCGGCGAGAAGGTGTTCCGTGTTAACTCGAGTTAACACGGAACACCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-699s21c1
Sequence:CCGGACCTGGACCAAGAGCCGATTTCTCGAGAAATCGGCTCTTGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001871
CPB1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase B1 (tissue)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-879s1c1
Sequence:CCGGGCTGATTTCATCCGCAACAAACTCGAGTTTGTTGCGGATGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-941s1c1
Sequence:CCGGCCAAATGATGATCTACCCTTACTCGAGTAAGGGTAGATCATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-448s1c1
Sequence:CCGGGCAGTGTTATCGGAACCACATCTCGAGATGTGGTTCCGATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-185s1c1
Sequence:CCGGGCCAGATTCTGTCACACAAATCTCGAGATTTGTGTGACAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-1124s1c1
Sequence:CCGGCCAAGGAATCAGATATTCCTTCTCGAGAAGGAATATCTGATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-662s21c1
Sequence:CCGGTGTCCTGCCTGTGCTCAATATCTCGAGATATTGAGCACAGGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-95s21c1
Sequence:CCGGCGAGAAGGTGTTCCGTGTTAACTCGAGTTAACACGGAACACCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-699s21c1
Sequence:CCGGACCTGGACCAAGAGCCGATTTCTCGAGAAATCGGCTCTTGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001871
CPB1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase B1 (tissue)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-879s1c1
Sequence:CCGGGCTGATTTCATCCGCAACAAACTCGAGTTTGTTGCGGATGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-941s1c1
Sequence:CCGGCCAAATGATGATCTACCCTTACTCGAGTAAGGGTAGATCATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-448s1c1
Sequence:CCGGGCAGTGTTATCGGAACCACATCTCGAGATGTGGTTCCGATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-185s1c1
Sequence:CCGGGCCAGATTCTGTCACACAAATCTCGAGATTTGTGTGACAGAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001871.1-1124s1c1
Sequence:CCGGCCAAGGAATCAGATATTCCTTCTCGAGAAGGAATATCTGATTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-662s21c1
Sequence:CCGGTGTCCTGCCTGTGCTCAATATCTCGAGATATTGAGCACAGGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-95s21c1
Sequence:CCGGCGAGAAGGTGTTCCGTGTTAACTCGAGTTAACACGGAACACCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001871.2-699s21c1
Sequence:CCGGACCTGGACCAAGAGCCGATTTCTCGAGAAATCGGCTCTTGGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130814
CPB1 MISSION shRNA Bacterial Glycerol Stock
carboxypeptidase B1 (tissue)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-1287s1c1
Sequence:CCGGGCAGTCAAGTACATTGCCAATCTCGAGATTGGCAATGTACTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-211s1c1
Sequence:CCGGCCAACACCAAACAGATTGATTCTCGAGAATCAATCTGTTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-249s1c1
Sequence:CCGGGCTACACAAGTGAAACCTCTTCTCGAGAAGAGGTTTCACTTGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-1302s1c1
Sequence:CCGGGCCAATTATGTCCTAGAGCATCTCGAGATGCTCTAGGACATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-986s1c1
Sequence:CCGGCCACTCCTACTCACAGATGATCTCGAGATCATCTGTGAGTAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130814
CPB1 MISSION shRNA shRNA Plasmid DNA
carboxypeptidase B1 (tissue)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-1287s1c1
Sequence:CCGGGCAGTCAAGTACATTGCCAATCTCGAGATTGGCAATGTACTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-211s1c1
Sequence:CCGGCCAACACCAAACAGATTGATTCTCGAGAATCAATCTGTTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-249s1c1
Sequence:CCGGGCTACACAAGTGAAACCTCTTCTCGAGAAGAGGTTTCACTTGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-1302s1c1
Sequence:CCGGGCCAATTATGTCCTAGAGCATCTCGAGATGCTCTAGGACATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-986s1c1
Sequence:CCGGCCACTCCTACTCACAGATGATCTCGAGATCATCTGTGAGTAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130814
CPB1 MISSION shRNA Lentiviral Transduction Particles
carboxypeptidase B1 (tissue)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-1287s1c1
Sequence:CCGGGCAGTCAAGTACATTGCCAATCTCGAGATTGGCAATGTACTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-211s1c1
Sequence:CCGGCCAACACCAAACAGATTGATTCTCGAGAATCAATCTGTTTGGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-249s1c1
Sequence:CCGGGCTACACAAGTGAAACCTCTTCTCGAGAAGAGGTTTCACTTGTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-1302s1c1
Sequence:CCGGGCCAATTATGTCCTAGAGCATCTCGAGATGCTCTAGGACATAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130814.2-986s1c1
Sequence:CCGGCCACTCCTACTCACAGATGATCTCGAGATCATCTGTGAGTAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks